EMAIL THIS PAGE TO A FRIEND

SNW1

SNW domain containing 1

Synonyms: Bx42 NCOA-62 PRPF45 Prp45 SKIIP SKIP
UniProtKB ID: Q13573, A8K8A9, Q13483, Q32N03, Q5D0D6
Gene ID:
Human(22938) Summary: This gene, a member of the SNW gene family, encodes a coactivator that enhances transcription from some Pol II promoters. This coactivator can bind to the ligand-binding domain of the vitamin D receptor and to retinoid receptors to enhance vitamin D-, retinoic acid-, estrogen-, and glucocorticoid-mediated gene expression. It can also function as a splicing factor by interacting with poly(A)-binding protein 2 to directly control the expression of muscle-specific genes at the transcriptional level. Finally, the protein may be involved in oncogenesis since it interacts with a region of SKI oncoproteins that is required for transforming activity. [provided by RefSeq, Jul 2008]
Mouse(66354) SNW domain containing 1
Rat(500695) SNW domain containing 1
Zebrafish(321852) SNW domain containing 1
domestic cat(101081813) SNW domain containing 1
dog(480405) SNW domain containing 1
chicken(423381) SNW domain containing 1
cow(326578) SNW domain containing 1
sheep(101115879) SNW domain containing 1
domestic guinea pig(100728254) SNW domain containing 1
Domestic Rabbit(100354981) SNW domain containing 1
naked mole-rat(101720009) SNW domain containing 1
85 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV32294 Anti-SKIIP antibody produced in rabbit affinity isolated antibody mouse, horse, canine, human, guinea pig, bovine, rat, rabbit
immunohistochemistry, western blot pricing
SAB3500226 Anti-SkiP antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunofluorescence, western blot pricing
HPA002457 Anti-SNW1 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
HPA017370 Anti-SNW1 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025507 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025507 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025507 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012245 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012245 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012245 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012245 Rosetta Predictions human pricing
NM_001109279 Rosetta Predictions rat pricing
NM_025507 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012245 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237529 predicted 709
2 SASI_Hs01_00237530 predicted 603
3 SASI_Hs01_00237531 predicted 1414
4 SASI_Hs01_00237532 predicted 461
5 SASI_Hs01_00237533 predicted 1184
6 SASI_Hs01_00237534 predicted 793
7 SASI_Hs01_00237535 predicted 1219
8 SASI_Hs01_00237536 predicted 438
9 SASI_Hs01_00237537 predicted 1139
10 SASI_Hs01_00237538 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109279 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246854 predicted 641
2 SASI_Rn02_00246855 predicted 1190
3 SASI_Rn02_00246856 predicted 1449
4 SASI_Rn02_00246857 predicted 653
5 SASI_Rn02_00246858 predicted 636
6 SASI_Rn02_00246859 predicted 801
7 SASI_Rn02_00246860 predicted 1248
8 SASI_Rn02_00246861 predicted 1188
9 SASI_Rn02_00246862 predicted 783
10 SASI_Rn02_00246863 predicted 865
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025507 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054358 predicted 1606
2 SASI_Mm02_00328388 predicted 741
3 SASI_Mm02_00328389 predicted 1091
4 SASI_Mm02_00328390 predicted 280
5 SASI_Mm02_00328391 predicted 377
6 SASI_Mm02_00328392 predicted 657
7 SASI_Mm01_00054362 predicted 1223
8 SASI_Mm02_00328393 predicted 619
9 SASI_Mm02_00328394 predicted 664
10 SASI_Mm01_00054363 predicted 1274
11 SASI_Mm01_00054359 predicted 979
12 SASI_Mm01_00054360 predicted 732
13 SASI_Mm01_00054361 predicted 395
14 SASI_Mm01_00054364 predicted 665
15 SASI_Mm01_00054365 predicted 801
16 SASI_Mm01_00054366 predicted 786
17 SASI_Mm01_00054367 predicted 1000
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025507
VALIDATED
SNW1 MISSION shRNA Bacterial Glycerol Stock
SNW domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108565    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025507.1-1055s1c1
Sequence:CCGGCTGGCCTCATTGTGAACAGATCTCGAGATCTGTTCACAATGAGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025507.1-787s1c1
Sequence:CCGGCCAGGATAAAGACCAACAGATCTCGAGATCTGTTGGTCTTTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025507.1-582s1c1
Sequence:CCGGCCCAATCCTCGAACTTCCAATCTCGAGATTGGAAGTTCGAGGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025507.1-588s1c1
Sequence:CCGGCCTCGAACTTCCAATGAAGTTCTCGAGAACTTCATTGGAAGTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025507.1-960s1c1
Sequence:CCGGCCCAAGGAACATGAGCATGAACTCGAGTTCATGCTCATGTTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025507.2-1227s21c1
Sequence:CCGGCCCAATCCTCGAACTTCCAATCTCGAGATTGGAAGTTCGAGGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025507.2-1605s21c1
Sequence:CCGGCCCAAGGAACATGAGCATGAACTCGAGTTCATGCTCATGTTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025507.2-184s21c1
Sequence:CCGGGCTGGATTCCAAGACTATTAGCTCGAGCTAATAGTCTTGGAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025507.2-1838s21c1
Sequence:CCGGATGACCAGGAGGGAGATAAAGCTCGAGCTTTATCTCCCTCCTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025507.2-441s21c1
Sequence:CCGGCCCGATGAAGAGGCAATTAAACTCGAGTTTAATTGCCTCTTCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025507
VALIDATED
SNW1 MISSION shRNA shRNA Plasmid DNA
SNW domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108565    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025507.1-1055s1c1
Sequence:CCGGCTGGCCTCATTGTGAACAGATCTCGAGATCTGTTCACAATGAGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025507.1-787s1c1
Sequence:CCGGCCAGGATAAAGACCAACAGATCTCGAGATCTGTTGGTCTTTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025507.1-582s1c1
Sequence:CCGGCCCAATCCTCGAACTTCCAATCTCGAGATTGGAAGTTCGAGGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025507.1-588s1c1
Sequence:CCGGCCTCGAACTTCCAATGAAGTTCTCGAGAACTTCATTGGAAGTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025507.1-960s1c1
Sequence:CCGGCCCAAGGAACATGAGCATGAACTCGAGTTCATGCTCATGTTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025507.2-1227s21c1
Sequence:CCGGCCCAATCCTCGAACTTCCAATCTCGAGATTGGAAGTTCGAGGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025507.2-1605s21c1
Sequence:CCGGCCCAAGGAACATGAGCATGAACTCGAGTTCATGCTCATGTTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025507.2-184s21c1
Sequence:CCGGGCTGGATTCCAAGACTATTAGCTCGAGCTAATAGTCTTGGAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025507.2-1838s21c1
Sequence:CCGGATGACCAGGAGGGAGATAAAGCTCGAGCTTTATCTCCCTCCTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025507.2-441s21c1
Sequence:CCGGCCCGATGAAGAGGCAATTAAACTCGAGTTTAATTGCCTCTTCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025507
VALIDATED
SNW1 MISSION shRNA Lentiviral Transduction Particles
SNW domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108565    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025507.1-1055s1c1
Sequence:CCGGCTGGCCTCATTGTGAACAGATCTCGAGATCTGTTCACAATGAGGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025507.1-787s1c1
Sequence:CCGGCCAGGATAAAGACCAACAGATCTCGAGATCTGTTGGTCTTTATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025507.1-582s1c1
Sequence:CCGGCCCAATCCTCGAACTTCCAATCTCGAGATTGGAAGTTCGAGGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025507.1-588s1c1
Sequence:CCGGCCTCGAACTTCCAATGAAGTTCTCGAGAACTTCATTGGAAGTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025507.1-960s1c1
Sequence:CCGGCCCAAGGAACATGAGCATGAACTCGAGTTCATGCTCATGTTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025507.2-1227s21c1
Sequence:CCGGCCCAATCCTCGAACTTCCAATCTCGAGATTGGAAGTTCGAGGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025507.2-1605s21c1
Sequence:CCGGCCCAAGGAACATGAGCATGAACTCGAGTTCATGCTCATGTTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025507.2-184s21c1
Sequence:CCGGGCTGGATTCCAAGACTATTAGCTCGAGCTAATAGTCTTGGAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025507.2-1838s21c1
Sequence:CCGGATGACCAGGAGGGAGATAAAGCTCGAGCTTTATCTCCCTCCTGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025507.2-441s21c1
Sequence:CCGGCCCGATGAAGAGGCAATTAAACTCGAGTTTAATTGCCTCTTCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012245
VALIDATED
SNW1 MISSION shRNA Bacterial Glycerol Stock
SNW domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012245.x-1641s1c1
Sequence:CCGGACAGGTCTCTCCAAAGTGAATCTCGAGATTCACTTTGGAGAGACCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012245.x-748s1c1
Sequence:CCGGGAACAACAAGAGTGGAAGATTCTCGAGAATCTTCCACTCTTGTTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012245.x-1421s1c1
Sequence:CCGGCCAGAATAAAGACCAACAGATCTCGAGATCTGTTGGTCTTTATTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012245.x-724s1c1
Sequence:CCGGCCTAGCCGAAAGATGACTGTACTCGAGTACAGTCATCTTTCGGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_012245.x-1594s1c1
Sequence:CCGGCCCAAGGAACACGAGCATGAACTCGAGTTCATGCTCGTGTTCCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012245.2-1594s21c1
Sequence:CCGGCCCAAGGAACACGAGCATGAACTCGAGTTCATGCTCGTGTTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_012245.2-598s21c1
Sequence:CCGGGGAGCTAAACAGAGGGTTATTCTCGAGAATAACCCTCTGTTTAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012245.2-429s21c1
Sequence:CCGGGCCCGATGAAGAAGCTATTAACTCGAGTTAATAGCTTCTTCATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_012245.2-748s21c1
Sequence:CCGGGAACAACAAGAGTGGAAGATTCTCGAGAATCTTCCACTCTTGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012245.2-1641s21c1
Sequence:CCGGACAGGTCTCTCCAAAGTGAATCTCGAGATTCACTTTGGAGAGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012245
VALIDATED
SNW1 MISSION shRNA shRNA Plasmid DNA
SNW domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012245.x-1641s1c1
Sequence:CCGGACAGGTCTCTCCAAAGTGAATCTCGAGATTCACTTTGGAGAGACCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012245.x-748s1c1
Sequence:CCGGGAACAACAAGAGTGGAAGATTCTCGAGAATCTTCCACTCTTGTTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012245.x-1421s1c1
Sequence:CCGGCCAGAATAAAGACCAACAGATCTCGAGATCTGTTGGTCTTTATTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012245.x-724s1c1
Sequence:CCGGCCTAGCCGAAAGATGACTGTACTCGAGTACAGTCATCTTTCGGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_012245.x-1594s1c1
Sequence:CCGGCCCAAGGAACACGAGCATGAACTCGAGTTCATGCTCGTGTTCCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012245.2-1594s21c1
Sequence:CCGGCCCAAGGAACACGAGCATGAACTCGAGTTCATGCTCGTGTTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_012245.2-598s21c1
Sequence:CCGGGGAGCTAAACAGAGGGTTATTCTCGAGAATAACCCTCTGTTTAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012245.2-429s21c1
Sequence:CCGGGCCCGATGAAGAAGCTATTAACTCGAGTTAATAGCTTCTTCATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_012245.2-748s21c1
Sequence:CCGGGAACAACAAGAGTGGAAGATTCTCGAGAATCTTCCACTCTTGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012245.2-1641s21c1
Sequence:CCGGACAGGTCTCTCCAAAGTGAATCTCGAGATTCACTTTGGAGAGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012245
VALIDATED
SNW1 MISSION shRNA Lentiviral Transduction Particles
SNW domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_012245.x-1641s1c1
Sequence:CCGGACAGGTCTCTCCAAAGTGAATCTCGAGATTCACTTTGGAGAGACCTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012245.x-748s1c1
Sequence:CCGGGAACAACAAGAGTGGAAGATTCTCGAGAATCTTCCACTCTTGTTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012245.x-1421s1c1
Sequence:CCGGCCAGAATAAAGACCAACAGATCTCGAGATCTGTTGGTCTTTATTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012245.x-724s1c1
Sequence:CCGGCCTAGCCGAAAGATGACTGTACTCGAGTACAGTCATCTTTCGGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_012245.x-1594s1c1
Sequence:CCGGCCCAAGGAACACGAGCATGAACTCGAGTTCATGCTCGTGTTCCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012245.2-1594s21c1
Sequence:CCGGCCCAAGGAACACGAGCATGAACTCGAGTTCATGCTCGTGTTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_012245.2-598s21c1
Sequence:CCGGGGAGCTAAACAGAGGGTTATTCTCGAGAATAACCCTCTGTTTAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012245.2-429s21c1
Sequence:CCGGGCCCGATGAAGAAGCTATTAACTCGAGTTAATAGCTTCTTCATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_012245.2-748s21c1
Sequence:CCGGGAACAACAAGAGTGGAAGATTCTCGAGAATCTTCCACTCTTGTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298470    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012245.2-1641s21c1
Sequence:CCGGACAGGTCTCTCCAAAGTGAATCTCGAGATTCACTTTGGAGAGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks