EMAIL THIS PAGE TO A FRIEND

SNX10

sorting nexin 10

Synonyms: OPTB8
UniProtKB ID: Q9Y5X0, E9PFH5, Q8IYT5
Gene ID:
Human(29887) Summary: This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like some family members. This gene may play a role in regulating endosome homeostasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
Mouse(71982) sorting nexin 10
Rat(297096) sorting nexin 10
cow(508836) sorting nexin 10
sheep(101106676) sorting nexin 10
naked mole-rat(101713644) sorting nexin 10
chicken(420628) sorting nexin 10
domestic cat(101099623) sorting nexin 10
dog(475261) sorting nexin 10
153 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028035 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028035 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028035 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013322 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013322 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013322 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU002851 MISSION® esiRNA esiRNA targeting mouse Snx10 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013322 Rosetta Predictions human pricing
NM_001013085 Rosetta Predictions rat pricing
NM_001127348 Rosetta Predictions mouse pricing
NM_001127349 Rosetta Predictions mouse pricing
NM_028035 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013322 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238916 predicted 639
2 SASI_Hs01_00238917 predicted 870
3 SASI_Hs01_00238919 predicted 606
4 SASI_Hs01_00238920 predicted 404
5 SASI_Hs01_00238921 predicted 649
6 SASI_Hs02_00344625 predicted 655
7 SASI_Hs02_00344626 predicted 873
8 SASI_Hs01_00238922 predicted 599
9 SASI_Hs02_00344627 predicted 606
10 SASI_Hs02_00344628 predicted 620
11 SASI_Hs01_00238918 predicted 923
12 SASI_Hs01_00238923 predicted 666
13 SASI_Hs01_00238924 predicted 845
14 SASI_Hs01_00238925 predicted 570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013085 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076205 predicted 767
2 SASI_Rn01_00076206 predicted 965
3 SASI_Rn01_00076207 predicted 974
4 SASI_Rn01_00076208 predicted 853
5 SASI_Rn01_00076210 predicted 878
6 SASI_Rn01_00076211 predicted 941
7 SASI_Rn01_00076213 predicted 776
8 SASI_Rn01_00076214 predicted 931
9 SASI_Rn02_00200723 predicted 448
10 SASI_Rn02_00200724 predicted 197
11 SASI_Rn01_00076209 predicted 743
12 SASI_Rn01_00076212 predicted 836
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127348 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310277 predicted 328
2 SASI_Mm02_00310278 predicted 797
3 SASI_Mm02_00310279 predicted 709
4 SASI_Mm02_00310280 predicted 972
5 SASI_Mm02_00310281 predicted 512
6 SASI_Mm02_00310282 predicted 585
7 SASI_Mm02_00310283 predicted 650
8 SASI_Mm02_00310284 predicted 652
9 SASI_Mm02_00310285 predicted 898
10 SASI_Mm02_00310286 predicted 924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127349 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310287 predicted 331
2 SASI_Mm02_00310288 predicted 801
3 SASI_Mm02_00310289 predicted 706
4 SASI_Mm02_00310290 predicted 973
5 SASI_Mm02_00310291 predicted 515
6 SASI_Mm02_00310292 predicted 595
7 SASI_Mm02_00310293 predicted 660
8 SASI_Mm02_00310294 predicted 663
9 SASI_Mm02_00310295 predicted 910
10 SASI_Mm02_00310296 predicted 930
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028035 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333186 predicted 426
2 SASI_Mm01_00147142 predicted 897
3 SASI_Mm01_00147143 predicted 810
4 SASI_Mm01_00147144 predicted 1077
5 SASI_Mm01_00147145 predicted 615
6 SASI_Mm02_00333187 predicted 691
7 SASI_Mm01_00147149 predicted 758
8 SASI_Mm01_00147146 predicted 756
9 SASI_Mm01_00147147 predicted 1002
10 SASI_Mm01_00147148 predicted 1027
11 SASI_Mm01_00147140 predicted 353
12 SASI_Mm01_00147141 predicted 419
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028035
VALIDATED
SNX10 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 10
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105710    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028035.2-2109s1c1
Sequence:CCGGGCCATTTACTTGGGTACTTAACTCGAGTTAAGTACCCAAGTAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028035.2-687s1c1
Sequence:CCGGGCCATTCACAAGTTTGCTTTACTCGAGTAAAGCAAACTTGTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028035.2-332s1c1
Sequence:CCGGGCACTCTTATATCGACTATGACTCGAGTCATAGTCGATATAAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028035.2-701s1c1
Sequence:CCGGTGCTTTAATGAATAGACGGTTCTCGAGAACCGTCTATTCATTAAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028035.2-702s1c1
Sequence:CCGGGCTTTAATGAATAGACGGTTTCTCGAGAAACCGTCTATTCATTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028035.4-712s21c1
Sequence:GTACCGGTAGACGGTTTCCCGAAGAAGACTCGAGTCTTCTTCGGGAAACCGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028035.4-624s21c1
Sequence:GTACCGGATCTGAACTCCGAGGACATTGCTCGAGCAATGTCCTCGGAGTTCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028035.4-451s21c1
Sequence:CCGGCAACGCGTTGCTGGTACAATTCTCGAGAATTGTACCAGCAACGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028035.4-812s21c1
Sequence:CCGGAGCAGTTCTCATGGATGTAAACTCGAGTTTACATCCATGAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028035.4-1175s21c1
Sequence:CCGGTTGGCGTATTAGTAGCATTTACTCGAGTAAATGCTACTAATACGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028035.4-751s21c1
Sequence:CCGGCGCCGACGTAGAGTATGATTCCTCGAGGAATCATACTCTACGTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028035.4-330s21c1
Sequence:CCGGGGCACTCTTATATCGACTATGCTCGAGCATAGTCGATATAAGAGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028035.4-577s21c1
Sequence:GTACCGGTGCACTCTTGCTTTCCGATAGCTCGAGCTATCGGAAAGCAAGAGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028035
VALIDATED
SNX10 MISSION shRNA shRNA Plasmid DNA
sorting nexin 10
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105710    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028035.2-2109s1c1
Sequence:CCGGGCCATTTACTTGGGTACTTAACTCGAGTTAAGTACCCAAGTAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028035.2-687s1c1
Sequence:CCGGGCCATTCACAAGTTTGCTTTACTCGAGTAAAGCAAACTTGTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028035.2-332s1c1
Sequence:CCGGGCACTCTTATATCGACTATGACTCGAGTCATAGTCGATATAAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028035.2-701s1c1
Sequence:CCGGTGCTTTAATGAATAGACGGTTCTCGAGAACCGTCTATTCATTAAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028035.2-702s1c1
Sequence:CCGGGCTTTAATGAATAGACGGTTTCTCGAGAAACCGTCTATTCATTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028035.4-712s21c1
Sequence:GTACCGGTAGACGGTTTCCCGAAGAAGACTCGAGTCTTCTTCGGGAAACCGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028035.4-624s21c1
Sequence:GTACCGGATCTGAACTCCGAGGACATTGCTCGAGCAATGTCCTCGGAGTTCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028035.4-451s21c1
Sequence:CCGGCAACGCGTTGCTGGTACAATTCTCGAGAATTGTACCAGCAACGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028035.4-812s21c1
Sequence:CCGGAGCAGTTCTCATGGATGTAAACTCGAGTTTACATCCATGAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028035.4-1175s21c1
Sequence:CCGGTTGGCGTATTAGTAGCATTTACTCGAGTAAATGCTACTAATACGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028035.4-751s21c1
Sequence:CCGGCGCCGACGTAGAGTATGATTCCTCGAGGAATCATACTCTACGTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028035.4-330s21c1
Sequence:CCGGGGCACTCTTATATCGACTATGCTCGAGCATAGTCGATATAAGAGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028035.4-577s21c1
Sequence:GTACCGGTGCACTCTTGCTTTCCGATAGCTCGAGCTATCGGAAAGCAAGAGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028035
VALIDATED
SNX10 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 10
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105710    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028035.2-2109s1c1
Sequence:CCGGGCCATTTACTTGGGTACTTAACTCGAGTTAAGTACCCAAGTAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_028035.2-687s1c1
Sequence:CCGGGCCATTCACAAGTTTGCTTTACTCGAGTAAAGCAAACTTGTGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028035.2-332s1c1
Sequence:CCGGGCACTCTTATATCGACTATGACTCGAGTCATAGTCGATATAAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028035.2-701s1c1
Sequence:CCGGTGCTTTAATGAATAGACGGTTCTCGAGAACCGTCTATTCATTAAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028035.2-702s1c1
Sequence:CCGGGCTTTAATGAATAGACGGTTTCTCGAGAAACCGTCTATTCATTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028035.4-712s21c1
Sequence:GTACCGGTAGACGGTTTCCCGAAGAAGACTCGAGTCTTCTTCGGGAAACCGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028035.4-624s21c1
Sequence:GTACCGGATCTGAACTCCGAGGACATTGCTCGAGCAATGTCCTCGGAGTTCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028035.4-451s21c1
Sequence:CCGGCAACGCGTTGCTGGTACAATTCTCGAGAATTGTACCAGCAACGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028035.4-812s21c1
Sequence:CCGGAGCAGTTCTCATGGATGTAAACTCGAGTTTACATCCATGAGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336449    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028035.4-1175s21c1
Sequence:CCGGTTGGCGTATTAGTAGCATTTACTCGAGTAAATGCTACTAATACGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028035.4-751s21c1
Sequence:CCGGCGCCGACGTAGAGTATGATTCCTCGAGGAATCATACTCTACGTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028035.4-330s21c1
Sequence:CCGGGGCACTCTTATATCGACTATGCTCGAGCATAGTCGATATAAGAGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028035.4-577s21c1
Sequence:GTACCGGTGCACTCTTGCTTTCCGATAGCTCGAGCTATCGGAAAGCAAGAGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013322
VALIDATED
SNX10 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 10
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013322.2-407s1c1
Sequence:CCGGCCAAAGTAATGCGTTGCTGGTCTCGAGACCAGCAACGCATTACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013322.2-752s1c1
Sequence:CCGGGCTTGGACACAGTAGTGATGACTCGAGTCATCACTACTGTGTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_013322.2-2010s1c1
Sequence:CCGGGCTTTGTTACCCAGCCTAATTCTCGAGAATTAGGCTGGGTAACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013322.2-355s1c1
Sequence:CCGGCATCCTGTGTACGAAGAAGATCTCGAGATCTTCTTCGTACACAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134926    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013322.2-1926s1c1
Sequence:CCGGCCAAGTTTCATCCATGTTGAACTCGAGTTCAACATGGATGAAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_013322.2-358s1c1
Sequence:CCGGCCTGTGTACGAAGAAGATATACTCGAGTATATCTTCTTCGTACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_013322.2-648s1c1
Sequence:CCGGGCAATTCACAAGTTTGCCTTACTCGAGTAAGGCAAACTTGTGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013322.2-290s1c1
Sequence:CCGGCTGGCATTCTTACATTGACTACTCGAGTAGTCAATGTAAGAATGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013322.2-505s1c1
Sequence:CCGGGTCTGGAAGATTTCCTCAGAACTCGAGTTCTGAGGAAATCTTCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013322.2-917s21c1
Sequence:GTACCGGTGTCATGATGTTAGGTATTTACTCGAGTAAATACCTAACATCATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013322.2-1140s21c1
Sequence:GTACCGGTAGGTAACTAAGTAGCATTTACTCGAGTAAATGCTACTTAGTTACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013322
VALIDATED
SNX10 MISSION shRNA shRNA Plasmid DNA
sorting nexin 10
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013322.2-407s1c1
Sequence:CCGGCCAAAGTAATGCGTTGCTGGTCTCGAGACCAGCAACGCATTACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013322.2-752s1c1
Sequence:CCGGGCTTGGACACAGTAGTGATGACTCGAGTCATCACTACTGTGTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_013322.2-2010s1c1
Sequence:CCGGGCTTTGTTACCCAGCCTAATTCTCGAGAATTAGGCTGGGTAACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013322.2-355s1c1
Sequence:CCGGCATCCTGTGTACGAAGAAGATCTCGAGATCTTCTTCGTACACAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134926    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013322.2-1926s1c1
Sequence:CCGGCCAAGTTTCATCCATGTTGAACTCGAGTTCAACATGGATGAAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_013322.2-358s1c1
Sequence:CCGGCCTGTGTACGAAGAAGATATACTCGAGTATATCTTCTTCGTACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_013322.2-648s1c1
Sequence:CCGGGCAATTCACAAGTTTGCCTTACTCGAGTAAGGCAAACTTGTGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013322.2-290s1c1
Sequence:CCGGCTGGCATTCTTACATTGACTACTCGAGTAGTCAATGTAAGAATGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013322.2-505s1c1
Sequence:CCGGGTCTGGAAGATTTCCTCAGAACTCGAGTTCTGAGGAAATCTTCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013322.2-917s21c1
Sequence:GTACCGGTGTCATGATGTTAGGTATTTACTCGAGTAAATACCTAACATCATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013322.2-1140s21c1
Sequence:GTACCGGTAGGTAACTAAGTAGCATTTACTCGAGTAAATGCTACTTAGTTACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013322
VALIDATED
SNX10 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 10
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013322.2-407s1c1
Sequence:CCGGCCAAAGTAATGCGTTGCTGGTCTCGAGACCAGCAACGCATTACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013322.2-752s1c1
Sequence:CCGGGCTTGGACACAGTAGTGATGACTCGAGTCATCACTACTGTGTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_013322.2-2010s1c1
Sequence:CCGGGCTTTGTTACCCAGCCTAATTCTCGAGAATTAGGCTGGGTAACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013322.2-355s1c1
Sequence:CCGGCATCCTGTGTACGAAGAAGATCTCGAGATCTTCTTCGTACACAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134926    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013322.2-1926s1c1
Sequence:CCGGCCAAGTTTCATCCATGTTGAACTCGAGTTCAACATGGATGAAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_013322.2-358s1c1
Sequence:CCGGCCTGTGTACGAAGAAGATATACTCGAGTATATCTTCTTCGTACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_013322.2-648s1c1
Sequence:CCGGGCAATTCACAAGTTTGCCTTACTCGAGTAAGGCAAACTTGTGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013322.2-290s1c1
Sequence:CCGGCTGGCATTCTTACATTGACTACTCGAGTAGTCAATGTAAGAATGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135595    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013322.2-505s1c1
Sequence:CCGGGTCTGGAAGATTTCCTCAGAACTCGAGTTCTGAGGAAATCTTCCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013322.2-917s21c1
Sequence:GTACCGGTGTCATGATGTTAGGTATTTACTCGAGTAAATACCTAACATCATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013322.2-1140s21c1
Sequence:GTACCGGTAGGTAACTAAGTAGCATTTACTCGAGTAAATGCTACTTAGTTACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks