EMAIL THIS PAGE TO A FRIEND

SNX11

sorting nexin 11

UniProtKB ID: Q9Y5W9, B3KRL6, D3DTV0, Q53YC0, Q9H885
Gene ID:
Human(29916) Summary: This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like some family members. This gene encodes a protein of unknown function. This gene results in two transcript variants differing in the 5' UTR, but encoding the same protein. [provided by RefSeq, Jul 2008]
Mouse(74479) sorting nexin 11
Rat(303493) sorting nexin 11
Zebrafish(492678) sorting nexin 11
chicken(429353) sorting nexin 11
dog(480542) sorting nexin 11
domestic cat(101083812) sorting nexin 11
naked mole-rat(101707652) sorting nexin 11
cow(534567) sorting nexin 11
sheep(101115886) sorting nexin 11
165 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028965 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028965 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028965 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013323 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013323 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013323 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013323 Rosetta Predictions human pricing
NM_152244 Rosetta Predictions human pricing
NM_001012012 Rosetta Predictions rat pricing
XM_573185 Rosetta Predictions rat pricing
NM_028965 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013323 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046678 predicted 1340
2 SASI_Hs01_00046679 predicted 1264
3 SASI_Hs01_00046680 predicted 698
4 SASI_Hs01_00046681 predicted 1124
5 SASI_Hs01_00046682 predicted 1201
6 SASI_Hs01_00046683 predicted 1205
7 SASI_Hs01_00046684 predicted 523
8 SASI_Hs01_00046685 predicted 482
9 SASI_Hs01_00046687 predicted 1346
10 SASI_Hs02_00344629 predicted 1117
11 SASI_Hs01_00046686 predicted 1275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152244 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080355 predicted 1425
2 SASI_Hs01_00080356 predicted 1354
3 SASI_Hs01_00080357 predicted 786
4 SASI_Hs01_00080358 predicted 1205
5 SASI_Hs01_00080359 predicted 1295
6 SASI_Hs01_00080360 predicted 1297
7 SASI_Hs01_00080361 predicted 611
8 SASI_Hs01_00080362 predicted 568
9 SASI_Hs01_00080364 predicted 1434
10 SASI_Hs02_00365742 predicted 1212
11 SASI_Hs01_00080363 predicted 1369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012012 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113078 predicted 602
2 SASI_Rn01_00113079 predicted 234
3 SASI_Rn01_00113080 predicted 496
4 SASI_Rn01_00113081 predicted 259
5 SASI_Rn02_00200093 predicted 592
6 SASI_Rn01_00113083 predicted 682
7 SASI_Rn01_00113084 predicted 669
8 SASI_Rn01_00113085 predicted 603
9 SASI_Rn01_00113086 predicted 409
10 SASI_Rn01_00113087 predicted 546
11 SASI_Rn01_00113082 predicted 429
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573185 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00171897 predicted 530
2 SASI_Rn01_00171898 predicted 522
3 SASI_Rn01_00171899 predicted 608
4 SASI_Rn01_00171900 predicted 608
5 SASI_Rn01_00171901 predicted 593
6 SASI_Rn01_00171902 predicted 595
7 SASI_Rn01_00171903 predicted 532
8 SASI_Rn01_00171904 predicted 524
9 SASI_Rn01_00171905 predicted 586
10 SASI_Rn01_00171906 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028965 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140240 predicted 1111
2 SASI_Mm01_00140241 predicted 1238
3 SASI_Mm01_00140242 predicted 1190
4 SASI_Mm01_00140243 predicted 254
5 SASI_Mm01_00140244 predicted 692
6 SASI_Mm01_00140245 predicted 318
7 SASI_Mm01_00140246 predicted 1200
8 SASI_Mm02_00334690 predicted 335
9 SASI_Mm01_00140247 predicted 1190
10 SASI_Mm02_00334691 predicted 335
11 SASI_Mm01_00140239 predicted 328
12 SASI_Mm01_00140248 predicted 1224
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028965
VALIDATED
SNX11 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 11
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028965.4-1343s21c1
Sequence:GTACCGGGTGGGTTTCTTCAGGTGTTTGCTCGAGCAAACACCTGAAGAAACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028965.3-353s21c1
Sequence:CCGGGACTATAAGATATTCCTCCATCTCGAGATGGAGGAATATCTTATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028965.3-517s21c1
Sequence:CCGGCTCCGATGAGTTCATTGAGAACTCGAGTTCTCAATGAACTCATCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028965.3-681s21c1
Sequence:CCGGCGGTGTCCGATGCCATTCTTTCTCGAGAAAGAATGGCATCGGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028965.4-1561s21c1
Sequence:GTACCGGCAGAGTGGTGAAGACGTATTCCTCGAGGAATACGTCTTCACCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028965.3-370s21c1
Sequence:CCGGCCATACGAACAGCAAGGCTTTCTCGAGAAAGCCTTGCTGTTCGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028965.2-2208s1c1
Sequence:CCGGCCTGAAATAAACTGCAAGTATCTCGAGATACTTGCAGTTTATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028965.2-517s1c1
Sequence:CCGGCTCCGATGAGTTCATTGAGAACTCGAGTTCTCAATGAACTCATCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028965.2-681s1c1
Sequence:CCGGCGGTGTCCGATGCCATTCTTTCTCGAGAAAGAATGGCATCGGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028965.2-353s1c1
Sequence:CCGGGACTATAAGATATTCCTCCATCTCGAGATGGAGGAATATCTTATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028965.2-370s1c1
Sequence:CCGGCCATACGAACAGCAAGGCTTTCTCGAGAAAGCCTTGCTGTTCGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028965
VALIDATED
SNX11 MISSION shRNA shRNA Plasmid DNA
sorting nexin 11
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028965.4-1343s21c1
Sequence:GTACCGGGTGGGTTTCTTCAGGTGTTTGCTCGAGCAAACACCTGAAGAAACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028965.3-353s21c1
Sequence:CCGGGACTATAAGATATTCCTCCATCTCGAGATGGAGGAATATCTTATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028965.3-517s21c1
Sequence:CCGGCTCCGATGAGTTCATTGAGAACTCGAGTTCTCAATGAACTCATCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028965.3-681s21c1
Sequence:CCGGCGGTGTCCGATGCCATTCTTTCTCGAGAAAGAATGGCATCGGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028965.4-1561s21c1
Sequence:GTACCGGCAGAGTGGTGAAGACGTATTCCTCGAGGAATACGTCTTCACCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028965.3-370s21c1
Sequence:CCGGCCATACGAACAGCAAGGCTTTCTCGAGAAAGCCTTGCTGTTCGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028965.2-2208s1c1
Sequence:CCGGCCTGAAATAAACTGCAAGTATCTCGAGATACTTGCAGTTTATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028965.2-517s1c1
Sequence:CCGGCTCCGATGAGTTCATTGAGAACTCGAGTTCTCAATGAACTCATCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028965.2-681s1c1
Sequence:CCGGCGGTGTCCGATGCCATTCTTTCTCGAGAAAGAATGGCATCGGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028965.2-353s1c1
Sequence:CCGGGACTATAAGATATTCCTCCATCTCGAGATGGAGGAATATCTTATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028965.2-370s1c1
Sequence:CCGGCCATACGAACAGCAAGGCTTTCTCGAGAAAGCCTTGCTGTTCGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028965
VALIDATED
SNX11 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 11
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028965.4-1343s21c1
Sequence:GTACCGGGTGGGTTTCTTCAGGTGTTTGCTCGAGCAAACACCTGAAGAAACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028965.3-353s21c1
Sequence:CCGGGACTATAAGATATTCCTCCATCTCGAGATGGAGGAATATCTTATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028965.3-517s21c1
Sequence:CCGGCTCCGATGAGTTCATTGAGAACTCGAGTTCTCAATGAACTCATCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028965.3-681s21c1
Sequence:CCGGCGGTGTCCGATGCCATTCTTTCTCGAGAAAGAATGGCATCGGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380823    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028965.4-1561s21c1
Sequence:GTACCGGCAGAGTGGTGAAGACGTATTCCTCGAGGAATACGTCTTCACCACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028965.3-370s21c1
Sequence:CCGGCCATACGAACAGCAAGGCTTTCTCGAGAAAGCCTTGCTGTTCGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105855    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028965.2-2208s1c1
Sequence:CCGGCCTGAAATAAACTGCAAGTATCTCGAGATACTTGCAGTTTATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028965.2-517s1c1
Sequence:CCGGCTCCGATGAGTTCATTGAGAACTCGAGTTCTCAATGAACTCATCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028965.2-681s1c1
Sequence:CCGGCGGTGTCCGATGCCATTCTTTCTCGAGAAAGAATGGCATCGGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028965.2-353s1c1
Sequence:CCGGGACTATAAGATATTCCTCCATCTCGAGATGGAGGAATATCTTATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028965.2-370s1c1
Sequence:CCGGCCATACGAACAGCAAGGCTTTCTCGAGAAAGCCTTGCTGTTCGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013323
VALIDATED
SNX11 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 11
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013323.2-622s1c1
Sequence:CCGGGACAGCCAGTTGCACCTATTCCTCGAGGAATAGGTGCAACTGGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013323.2-396s1c1
Sequence:CCGGTACCAACAGCAAAGCCTTTACCTCGAGGTAAAGGCTTTGCTGTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013323.2-396s21c1
Sequence:CCGGTACCAACAGCAAAGCCTTTACCTCGAGGTAAAGGCTTTGCTGTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013323.2-2136s21c1
Sequence:CCGGGCATTGCTCTACTCTTAGGTTCTCGAGAACCTAAGAGTAGAGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013323.2-621s21c1
Sequence:GTACCGGAGACAGCCAGTTGCACCTATTCTCGAGAATAGGTGCAACTGGCTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013323.2-812s21c1
Sequence:CCGGGCTTTCTTCCAAGATCGGGTACTCGAGTACCCGATCTTGGAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013323.2-547s21c1
Sequence:CCGGGAGTTCATTGAGAAGCGACGACTCGAGTCGTCGCTTCTCAATGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_013323.2-812s1c1
Sequence:CCGGGCTTTCTTCCAAGATCGGGTACTCGAGTACCCGATCTTGGAAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013323.2-310s1c1
Sequence:CCGGGAGGTGATTACAGTGCGTGTTCTCGAGAACACGCACTGTAATCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_013323.2-1422s1c1
Sequence:CCGGGCAAATTCTAAGCTGCCATATCTCGAGATATGGCAGCTTAGAATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013323.2-540s1c1
Sequence:CCGGCTCAGATGAGTTCATTGAGAACTCGAGTTCTCAATGAACTCATCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_013323.2-716s1c1
Sequence:CCGGCCATTCTTCGATATGCTATGTCTCGAGACATAGCATATCGAAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013323.2-1048s1c1
Sequence:CCGGCCTGGTCAGTTAGAAACAGTTCTCGAGAACTGTTTCTAACTGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127684    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_013323.2-2136s1c1
Sequence:CCGGGCATTGCTCTACTCTTAGGTTCTCGAGAACCTAAGAGTAGAGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013323.2-547s1c1
Sequence:CCGGGAGTTCATTGAGAAGCGACGACTCGAGTCGTCGCTTCTCAATGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013323
VALIDATED
SNX11 MISSION shRNA shRNA Plasmid DNA
sorting nexin 11
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013323.2-622s1c1
Sequence:CCGGGACAGCCAGTTGCACCTATTCCTCGAGGAATAGGTGCAACTGGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013323.2-396s1c1
Sequence:CCGGTACCAACAGCAAAGCCTTTACCTCGAGGTAAAGGCTTTGCTGTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013323.2-396s21c1
Sequence:CCGGTACCAACAGCAAAGCCTTTACCTCGAGGTAAAGGCTTTGCTGTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013323.2-2136s21c1
Sequence:CCGGGCATTGCTCTACTCTTAGGTTCTCGAGAACCTAAGAGTAGAGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013323.2-621s21c1
Sequence:GTACCGGAGACAGCCAGTTGCACCTATTCTCGAGAATAGGTGCAACTGGCTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013323.2-812s21c1
Sequence:CCGGGCTTTCTTCCAAGATCGGGTACTCGAGTACCCGATCTTGGAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013323.2-547s21c1
Sequence:CCGGGAGTTCATTGAGAAGCGACGACTCGAGTCGTCGCTTCTCAATGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_013323.2-812s1c1
Sequence:CCGGGCTTTCTTCCAAGATCGGGTACTCGAGTACCCGATCTTGGAAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013323.2-310s1c1
Sequence:CCGGGAGGTGATTACAGTGCGTGTTCTCGAGAACACGCACTGTAATCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_013323.2-1422s1c1
Sequence:CCGGGCAAATTCTAAGCTGCCATATCTCGAGATATGGCAGCTTAGAATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013323.2-540s1c1
Sequence:CCGGCTCAGATGAGTTCATTGAGAACTCGAGTTCTCAATGAACTCATCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_013323.2-716s1c1
Sequence:CCGGCCATTCTTCGATATGCTATGTCTCGAGACATAGCATATCGAAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013323.2-1048s1c1
Sequence:CCGGCCTGGTCAGTTAGAAACAGTTCTCGAGAACTGTTTCTAACTGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127684    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_013323.2-2136s1c1
Sequence:CCGGGCATTGCTCTACTCTTAGGTTCTCGAGAACCTAAGAGTAGAGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013323.2-547s1c1
Sequence:CCGGGAGTTCATTGAGAAGCGACGACTCGAGTCGTCGCTTCTCAATGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013323
VALIDATED
SNX11 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 11
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013323.2-622s1c1
Sequence:CCGGGACAGCCAGTTGCACCTATTCCTCGAGGAATAGGTGCAACTGGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013323.2-396s1c1
Sequence:CCGGTACCAACAGCAAAGCCTTTACCTCGAGGTAAAGGCTTTGCTGTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013323.2-396s21c1
Sequence:CCGGTACCAACAGCAAAGCCTTTACCTCGAGGTAAAGGCTTTGCTGTTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013323.2-2136s21c1
Sequence:CCGGGCATTGCTCTACTCTTAGGTTCTCGAGAACCTAAGAGTAGAGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013323.2-621s21c1
Sequence:GTACCGGAGACAGCCAGTTGCACCTATTCTCGAGAATAGGTGCAACTGGCTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013323.2-812s21c1
Sequence:CCGGGCTTTCTTCCAAGATCGGGTACTCGAGTACCCGATCTTGGAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013323.2-547s21c1
Sequence:CCGGGAGTTCATTGAGAAGCGACGACTCGAGTCGTCGCTTCTCAATGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_013323.2-812s1c1
Sequence:CCGGGCTTTCTTCCAAGATCGGGTACTCGAGTACCCGATCTTGGAAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013323.2-310s1c1
Sequence:CCGGGAGGTGATTACAGTGCGTGTTCTCGAGAACACGCACTGTAATCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130509    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_013323.2-1422s1c1
Sequence:CCGGGCAAATTCTAAGCTGCCATATCTCGAGATATGGCAGCTTAGAATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013323.2-540s1c1
Sequence:CCGGCTCAGATGAGTTCATTGAGAACTCGAGTTCTCAATGAACTCATCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_013323.2-716s1c1
Sequence:CCGGCCATTCTTCGATATGCTATGTCTCGAGACATAGCATATCGAAGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013323.2-1048s1c1
Sequence:CCGGCCTGGTCAGTTAGAAACAGTTCTCGAGAACTGTTTCTAACTGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127684    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_013323.2-2136s1c1
Sequence:CCGGGCATTGCTCTACTCTTAGGTTCTCGAGAACCTAAGAGTAGAGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013323.2-547s1c1
Sequence:CCGGGAGTTCATTGAGAAGCGACGACTCGAGTCGTCGCTTCTCAATGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks