EMAIL THIS PAGE TO A FRIEND

SNX12

sorting nexin 12

UniProtKB ID: Q9UMY4, F8W8K5, Q8WUG9
Gene ID:
Human(29934) Summary: This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like some family members. A similar protein in mouse may be involved in regulating the neurite outgrowth. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Mouse(55988) sorting nexin 12
Rat(363478) sorting nexin 12
cow(520739) sorting nexin 12
sheep(101102785) sorting nexin 12
naked mole-rat(101712753) sorting nexin 12
Zebrafish(394098) sorting nexin 12
domestic cat(101089586) sorting nexin 12
dog(612768) sorting nexin 12
chicken(428704) sorting nexin 12
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013346 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013346 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013346 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018875 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018875 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018875 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013346 Rosetta Predictions human pricing
NM_001108817 Rosetta Predictions rat pricing
NM_001110310 Rosetta Predictions mouse pricing
NM_001110311 Rosetta Predictions mouse pricing
NM_018875 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013346 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144909 predicted 237
2 SASI_Hs01_00144910 predicted 242
3 SASI_Hs02_00344660 predicted 200
4 SASI_Hs02_00344661 predicted 408
5 SASI_Hs01_00144911 predicted 391
6 SASI_Hs01_00144913 predicted 343
7 SASI_Hs01_00144914 predicted 211
8 SASI_Hs01_00144915 predicted 221
9 SASI_Hs01_00144916 predicted 274
10 SASI_Hs01_00144917 predicted 271
11 SASI_Hs01_00144912 predicted 288
12 SASI_Hs01_00144918 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108817 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242365 predicted 276
2 SASI_Rn02_00242366 predicted 261
3 SASI_Rn02_00242367 predicted 265
4 SASI_Rn02_00242368 predicted 308
5 SASI_Rn02_00242369 predicted 311
6 SASI_Rn02_00242370 predicted 260
7 SASI_Rn02_00242371 predicted 207
8 SASI_Rn02_00242372 predicted 265
9 SASI_Rn02_00242373 predicted 376
10 SASI_Rn02_00242374 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110310 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305346 predicted 344
2 SASI_Mm02_00305347 predicted 258
3 SASI_Mm02_00305348 predicted 301
4 SASI_Mm02_00305349 predicted 373
5 SASI_Mm02_00305350 predicted 330
6 SASI_Mm02_00305351 predicted 225
7 SASI_Mm02_00305352 predicted 195
8 SASI_Mm02_00305353 predicted 384
9 SASI_Mm02_00305354 predicted 327
10 SASI_Mm02_00305355 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110311 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305356 predicted 344
2 SASI_Mm02_00305357 predicted 258
3 SASI_Mm02_00305358 predicted 301
4 SASI_Mm02_00305359 predicted 372
5 SASI_Mm02_00305360 predicted 328
6 SASI_Mm02_00305361 predicted 223
7 SASI_Mm02_00305362 predicted 196
8 SASI_Mm02_00305363 predicted 387
9 SASI_Mm02_00305364 predicted 331
10 SASI_Mm02_00305365 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018875 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047844 predicted 343
2 SASI_Mm02_00324268 predicted 261
3 SASI_Mm01_00047845 predicted 305
4 SASI_Mm02_00324269 predicted 376
5 SASI_Mm01_00047847 predicted 326
6 SASI_Mm02_00324270 predicted 227
7 SASI_Mm02_00324271 predicted 195
8 SASI_Mm01_00047849 predicted 379
9 SASI_Mm01_00047851 predicted 329
10 SASI_Mm01_00047852 predicted 274
11 SASI_Mm01_00047846 predicted 391
12 SASI_Mm01_00047848 predicted 316
13 SASI_Mm01_00047850 predicted 387
14 SASI_Mm01_00047853 predicted 374
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013346
VALIDATED
SNX12 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 12
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013346.2-163s1c1
Sequence:CCGGCTGGAGATCGACATCTTTAATCTCGAGATTAAAGATGTCGATCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013346.2-237s1c1
Sequence:CCGGGCGGACAAACCTACCTATCTTCTCGAGAAGATAGGTAGGTTTGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013346.2-409s1c1
Sequence:CCGGGAGGAGTCTTTCATCGAAGAACTCGAGTTCTTCGATGAAAGACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013346.2-492s21c1
Sequence:CCGGACGCTGCCTACACATGTTCCTCTCGAGAGGAACATGTGTAGGCAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013346.2-285s21c1
Sequence:CCGGGCGCTACAGTGACTTTGAGTGCTCGAGCACTCAAAGTCACTGTAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013346.2-473s21c1
Sequence:CCGGACCCACTGGCTCAGAATGAACCTCGAGGTTCATTCTGAGCCAGTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013346.2-320s1c1
Sequence:CCGGTGGAGAGAGATAGCAAGATTGCTCGAGCAATCTTGCTATCTCTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013346.2-212s1c1
Sequence:CCGGGCTTCACCACCTATGAGGTTCCTCGAGGAACCTCATAGGTGGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013346
VALIDATED
SNX12 MISSION shRNA shRNA Plasmid DNA
sorting nexin 12
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013346.2-163s1c1
Sequence:CCGGCTGGAGATCGACATCTTTAATCTCGAGATTAAAGATGTCGATCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013346.2-237s1c1
Sequence:CCGGGCGGACAAACCTACCTATCTTCTCGAGAAGATAGGTAGGTTTGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013346.2-409s1c1
Sequence:CCGGGAGGAGTCTTTCATCGAAGAACTCGAGTTCTTCGATGAAAGACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013346.2-492s21c1
Sequence:CCGGACGCTGCCTACACATGTTCCTCTCGAGAGGAACATGTGTAGGCAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013346.2-285s21c1
Sequence:CCGGGCGCTACAGTGACTTTGAGTGCTCGAGCACTCAAAGTCACTGTAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013346.2-473s21c1
Sequence:CCGGACCCACTGGCTCAGAATGAACCTCGAGGTTCATTCTGAGCCAGTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013346.2-320s1c1
Sequence:CCGGTGGAGAGAGATAGCAAGATTGCTCGAGCAATCTTGCTATCTCTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013346.2-212s1c1
Sequence:CCGGGCTTCACCACCTATGAGGTTCCTCGAGGAACCTCATAGGTGGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013346
VALIDATED
SNX12 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 12
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013346.2-163s1c1
Sequence:CCGGCTGGAGATCGACATCTTTAATCTCGAGATTAAAGATGTCGATCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013346.2-237s1c1
Sequence:CCGGGCGGACAAACCTACCTATCTTCTCGAGAAGATAGGTAGGTTTGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013346.2-409s1c1
Sequence:CCGGGAGGAGTCTTTCATCGAAGAACTCGAGTTCTTCGATGAAAGACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013346.2-492s21c1
Sequence:CCGGACGCTGCCTACACATGTTCCTCTCGAGAGGAACATGTGTAGGCAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013346.2-285s21c1
Sequence:CCGGGCGCTACAGTGACTTTGAGTGCTCGAGCACTCAAAGTCACTGTAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013346.2-473s21c1
Sequence:CCGGACCCACTGGCTCAGAATGAACCTCGAGGTTCATTCTGAGCCAGTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_013346.2-320s1c1
Sequence:CCGGTGGAGAGAGATAGCAAGATTGCTCGAGCAATCTTGCTATCTCTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013346.2-212s1c1
Sequence:CCGGGCTTCACCACCTATGAGGTTCCTCGAGGAACCTCATAGGTGGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018875
SNX12 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 12
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018875.1-314s1c1
Sequence:CCGGCGAGATAGTAAGATCGTAGTACTCGAGTACTACGATCTTACTATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018875.1-427s1c1
Sequence:CCGGCCTCGAACAGTTTATTAACAACTCGAGTTGTTAATAAACTGTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018875.1-152s1c1
Sequence:CCGGCTGGAGATAGACATCTTTAATCTCGAGATTAAAGATGTCTATCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018875.1-236s1c1
Sequence:CCGGCTACCCATCTTCAAGCTGAAACTCGAGTTTCAGCTTGAAGATGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018875.1-467s1c1
Sequence:CCGGGCTCAGAATGAACGCTGTCTACTCGAGTAGACAGCGTTCATTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018875.2-309s21c1
Sequence:CCGGCTACCCATCTTCAAGCTGAAACTCGAGTTTCAGCTTGAAGATGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018875.2-543s21c1
Sequence:CCGGGCTCAGAATGAACGCTGTCTACTCGAGTAGACAGCGTTCATTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018875.2-225s21c1
Sequence:CCGGCTGGAGATAGACATCTTTAATCTCGAGATTAAAGATGTCTATCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018875.2-503s21c1
Sequence:CCGGCCTCGAACAGTTTATTAACAACTCGAGTTGTTAATAAACTGTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018875
SNX12 MISSION shRNA shRNA Plasmid DNA
sorting nexin 12
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018875.1-314s1c1
Sequence:CCGGCGAGATAGTAAGATCGTAGTACTCGAGTACTACGATCTTACTATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018875.1-427s1c1
Sequence:CCGGCCTCGAACAGTTTATTAACAACTCGAGTTGTTAATAAACTGTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018875.1-152s1c1
Sequence:CCGGCTGGAGATAGACATCTTTAATCTCGAGATTAAAGATGTCTATCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018875.1-236s1c1
Sequence:CCGGCTACCCATCTTCAAGCTGAAACTCGAGTTTCAGCTTGAAGATGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018875.1-467s1c1
Sequence:CCGGGCTCAGAATGAACGCTGTCTACTCGAGTAGACAGCGTTCATTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018875.2-309s21c1
Sequence:CCGGCTACCCATCTTCAAGCTGAAACTCGAGTTTCAGCTTGAAGATGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018875.2-543s21c1
Sequence:CCGGGCTCAGAATGAACGCTGTCTACTCGAGTAGACAGCGTTCATTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018875.2-225s21c1
Sequence:CCGGCTGGAGATAGACATCTTTAATCTCGAGATTAAAGATGTCTATCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018875.2-503s21c1
Sequence:CCGGCCTCGAACAGTTTATTAACAACTCGAGTTGTTAATAAACTGTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018875
SNX12 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 12
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018875.1-314s1c1
Sequence:CCGGCGAGATAGTAAGATCGTAGTACTCGAGTACTACGATCTTACTATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018875.1-427s1c1
Sequence:CCGGCCTCGAACAGTTTATTAACAACTCGAGTTGTTAATAAACTGTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018875.1-152s1c1
Sequence:CCGGCTGGAGATAGACATCTTTAATCTCGAGATTAAAGATGTCTATCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018875.1-236s1c1
Sequence:CCGGCTACCCATCTTCAAGCTGAAACTCGAGTTTCAGCTTGAAGATGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018875.1-467s1c1
Sequence:CCGGGCTCAGAATGAACGCTGTCTACTCGAGTAGACAGCGTTCATTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018875.2-309s21c1
Sequence:CCGGCTACCCATCTTCAAGCTGAAACTCGAGTTTCAGCTTGAAGATGGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018875.2-543s21c1
Sequence:CCGGGCTCAGAATGAACGCTGTCTACTCGAGTAGACAGCGTTCATTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018875.2-225s21c1
Sequence:CCGGCTGGAGATAGACATCTTTAATCTCGAGATTAAAGATGTCTATCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018875.2-503s21c1
Sequence:CCGGCCTCGAACAGTTTATTAACAACTCGAGTTGTTAATAAACTGTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks