EMAIL THIS PAGE TO A FRIEND

SNX13

sorting nexin 13

Synonyms: RGS-PX1
UniProtKB ID: Q9Y5W8, B2RCI9, O94821, Q8WVZ2, Q8WXH8
Gene ID:
Human(23161) Summary: This gene encodes a PHOX domain- and RGS domain-containing protein that belongs to the sorting nexin (SNX) family and the regulator of G protein signaling (RGS) family. The PHOX domain is a phosphoinositide binding domain, and the SNX family members are involved in intracellular trafficking. The RGS family members are regulatory molecules that act as GTPase activating proteins for G alpha subunits of heterotrimeric G proteins. The RGS domain of this protein interacts with G alpha(s), accelerates its GTP hydrolysis, and attenuates G alpha(s)-mediated signaling. Overexpression of this protein delayes lysosomal degradation of the epidermal growth factor receptor. Because of its bifunctional role, this protein may link heterotrimeric G protein signaling and vesicular trafficking. [provided by RefSeq, Jul 2008]
Mouse(217463) sorting nexin 13
Rat(362731) sorting nexin 13
Zebrafish(503733) sorting nexin 13
domestic cat(101085193) sorting nexin 13
Horse(100066218) sorting nexin 13
dog(475252) sorting nexin 13
chicken(420598) sorting nexin 13
naked mole-rat(101708022) sorting nexin 13
cow(532001) sorting nexin 13
sheep(101118182) sorting nexin 13
186 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015132 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015132 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015132 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001014973 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001014973 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001014973 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015132 Rosetta Predictions human pricing
NM_001108708 Rosetta Predictions rat pricing
NM_001014973 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015132 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014050 predicted 2475
2 SASI_Hs02_00347055 predicted 1884
3 SASI_Hs01_00014051 predicted 3045
4 SASI_Hs01_00014052 predicted 550
5 SASI_Hs01_00014054 predicted 2391
6 SASI_Hs02_00347056 predicted 2611
7 SASI_Hs01_00014055 predicted 545
8 SASI_Hs02_00347057 predicted 958
9 SASI_Hs01_00014057 predicted 1336
10 SASI_Hs01_00014058 predicted 1063
11 SASI_Hs01_00014053 predicted 388
12 SASI_Hs01_00014056 predicted 1222
13 SASI_Hs01_00014059 predicted 2794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108708 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241295 predicted 548
2 SASI_Rn02_00241296 predicted 2574
3 SASI_Rn02_00241297 predicted 1520
4 SASI_Rn02_00241298 predicted 2024
5 SASI_Rn02_00241299 predicted 2391
6 SASI_Rn02_00241300 predicted 1854
7 SASI_Rn02_00241301 predicted 2264
8 SASI_Rn02_00241302 predicted 324
9 SASI_Rn02_00241303 predicted 2378
10 SASI_Rn02_00241304 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014973 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028692 predicted 1628
2 SASI_Mm01_00028693 predicted 1374
3 SASI_Mm01_00028694 predicted 1977
4 SASI_Mm01_00028695 predicted 2503
5 SASI_Mm02_00287448 predicted 933
6 SASI_Mm01_00028696 predicted 2592
7 SASI_Mm01_00028697 predicted 535
8 SASI_Mm01_00028698 predicted 2473
9 SASI_Mm01_00028699 predicted 2926
10 SASI_Mm01_00028700 predicted 2835
11 SASI_Mm01_00028691 predicted 2892
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015132
VALIDATED
SNX13 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 13
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015132.4-708s21c1
Sequence:GTACCGGTGGCACACACTTACGAGTATTCTCGAGAATACTCGTAAGTGTGTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015132.3-4547s21c1
Sequence:CCGGGTATTGGTATCCCAGTTATTTCTCGAGAAATAACTGGGATACCAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_015132.3-1888s21c1
Sequence:GTACCGGTACAACTTCATGCCTACATTTCTCGAGAAATGTAGGCATGAAGTTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_015132.3-2551s21c1
Sequence:GTACCGGTGGATGAAGTATTCGACTTAACTCGAGTTAAGTCGAATACTTCATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015132.3-2903s21c1
Sequence:GTACCGGGTTTCAGCACAACCAATTAAACTCGAGTTTAATTGGTTGTGCTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_015132.3-2490s21c1
Sequence:CCGGTCGGCTCAACTTGACGATAATCTCGAGATTATCGTCAAGTTGAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015132.4-517s21c1
Sequence:GTACCGGGAACCTCTCCAGCAAGTTATCCTCGAGGATAACTTGCTGGAGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015132.4-2061s21c1
Sequence:GTACCGGTGAAAGTCTCTCAAGCATATTCTCGAGAATATGCTTGAGAGACTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015132.4-3505s21c1
Sequence:GTACCGGAGGAGTTTGTTTGGCATAATGCTCGAGCATTATGCCAAACAAACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015132.4-2610s21c1
Sequence:GTACCGGCCTACTTCAACAGCTTATTAGCTCGAGCTAATAAGCTGTTGAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015132.2-924s1c1
Sequence:CCGGCCAGAACAAGATCATGCGATACTCGAGTATCGCATGATCTTGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015132.2-2827s1c1
Sequence:CCGGGATGAGCTGAAGCACATTATTCTCGAGAATAATGTGCTTCAGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_015132.2-1635s1c1
Sequence:CCGGCCCTGAAATCTTTGATGACATCTCGAGATGTCATCAAAGATTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_015132.2-2290s1c1
Sequence:CCGGCGCAATTCAATGAGGAATGTTCTCGAGAACATTCCTCATTGAATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015132.2-1042s1c1
Sequence:CCGGCGTGATTCTAACTGCAACTATCTCGAGATAGTTGCAGTTAGAATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015132
VALIDATED
SNX13 MISSION shRNA shRNA Plasmid DNA
sorting nexin 13
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015132.4-708s21c1
Sequence:GTACCGGTGGCACACACTTACGAGTATTCTCGAGAATACTCGTAAGTGTGTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015132.3-4547s21c1
Sequence:CCGGGTATTGGTATCCCAGTTATTTCTCGAGAAATAACTGGGATACCAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_015132.3-1888s21c1
Sequence:GTACCGGTACAACTTCATGCCTACATTTCTCGAGAAATGTAGGCATGAAGTTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_015132.3-2551s21c1
Sequence:GTACCGGTGGATGAAGTATTCGACTTAACTCGAGTTAAGTCGAATACTTCATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015132.3-2903s21c1
Sequence:GTACCGGGTTTCAGCACAACCAATTAAACTCGAGTTTAATTGGTTGTGCTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_015132.3-2490s21c1
Sequence:CCGGTCGGCTCAACTTGACGATAATCTCGAGATTATCGTCAAGTTGAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015132.4-517s21c1
Sequence:GTACCGGGAACCTCTCCAGCAAGTTATCCTCGAGGATAACTTGCTGGAGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015132.4-2061s21c1
Sequence:GTACCGGTGAAAGTCTCTCAAGCATATTCTCGAGAATATGCTTGAGAGACTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015132.4-3505s21c1
Sequence:GTACCGGAGGAGTTTGTTTGGCATAATGCTCGAGCATTATGCCAAACAAACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015132.4-2610s21c1
Sequence:GTACCGGCCTACTTCAACAGCTTATTAGCTCGAGCTAATAAGCTGTTGAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015132.2-924s1c1
Sequence:CCGGCCAGAACAAGATCATGCGATACTCGAGTATCGCATGATCTTGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015132.2-2827s1c1
Sequence:CCGGGATGAGCTGAAGCACATTATTCTCGAGAATAATGTGCTTCAGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_015132.2-1635s1c1
Sequence:CCGGCCCTGAAATCTTTGATGACATCTCGAGATGTCATCAAAGATTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_015132.2-2290s1c1
Sequence:CCGGCGCAATTCAATGAGGAATGTTCTCGAGAACATTCCTCATTGAATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015132.2-1042s1c1
Sequence:CCGGCGTGATTCTAACTGCAACTATCTCGAGATAGTTGCAGTTAGAATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015132
VALIDATED
SNX13 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 13
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015132.4-708s21c1
Sequence:GTACCGGTGGCACACACTTACGAGTATTCTCGAGAATACTCGTAAGTGTGTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015132.3-4547s21c1
Sequence:CCGGGTATTGGTATCCCAGTTATTTCTCGAGAAATAACTGGGATACCAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_015132.3-1888s21c1
Sequence:GTACCGGTACAACTTCATGCCTACATTTCTCGAGAAATGTAGGCATGAAGTTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_015132.3-2551s21c1
Sequence:GTACCGGTGGATGAAGTATTCGACTTAACTCGAGTTAAGTCGAATACTTCATCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_015132.3-2903s21c1
Sequence:GTACCGGGTTTCAGCACAACCAATTAAACTCGAGTTTAATTGGTTGTGCTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_015132.3-2490s21c1
Sequence:CCGGTCGGCTCAACTTGACGATAATCTCGAGATTATCGTCAAGTTGAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015132.4-517s21c1
Sequence:GTACCGGGAACCTCTCCAGCAAGTTATCCTCGAGGATAACTTGCTGGAGAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015132.4-2061s21c1
Sequence:GTACCGGTGAAAGTCTCTCAAGCATATTCTCGAGAATATGCTTGAGAGACTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015132.4-3505s21c1
Sequence:GTACCGGAGGAGTTTGTTTGGCATAATGCTCGAGCATTATGCCAAACAAACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015132.4-2610s21c1
Sequence:GTACCGGCCTACTTCAACAGCTTATTAGCTCGAGCTAATAAGCTGTTGAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_015132.2-924s1c1
Sequence:CCGGCCAGAACAAGATCATGCGATACTCGAGTATCGCATGATCTTGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015132.2-2827s1c1
Sequence:CCGGGATGAGCTGAAGCACATTATTCTCGAGAATAATGTGCTTCAGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_015132.2-1635s1c1
Sequence:CCGGCCCTGAAATCTTTGATGACATCTCGAGATGTCATCAAAGATTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_015132.2-2290s1c1
Sequence:CCGGCGCAATTCAATGAGGAATGTTCTCGAGAACATTCCTCATTGAATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015132.2-1042s1c1
Sequence:CCGGCGTGATTCTAACTGCAACTATCTCGAGATAGTTGCAGTTAGAATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001014973
VALIDATED
SNX13 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 13
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001014973.2-457s21c1
Sequence:GTACCGGACGCGAAGCCAGGACTATAAACTCGAGTTTATAGTCCTGGCTTCGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001014973.2-706s21c1
Sequence:GTACCGGTGGCACTCACCTACGAGTATTCTCGAGAATACTCGTAGGTGAGTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381387    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001014973.2-3277s21c1
Sequence:GTACCGGACATGGTTTGCTGCGTTATTTCTCGAGAAATAACGCAGCAAACCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001014973.1-3892s1c1
Sequence:CCGGGCCAAATACATTGTCCTTCTACTCGAGTAGAAGGACAATGTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014973.1-1981s1c1
Sequence:CCGGCGGCGTTATAGTGACTTCCATCTCGAGATGGAAGTCACTATAACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014973.1-2944s1c1
Sequence:CCGGCCACAGTATAAATTTCGTGAACTCGAGTTCACGAAATTTATACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014973.1-2865s1c1
Sequence:CCGGGTTTGAAATGTTTCAGCACAACTCGAGTTGTGCTGAAACATTTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014973.1-2299s1c1
Sequence:CCGGGCAGTCAAATCCCTTCCTGATCTCGAGATCAGGAAGGGATTTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001014973
VALIDATED
SNX13 MISSION shRNA shRNA Plasmid DNA
sorting nexin 13
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001014973.2-457s21c1
Sequence:GTACCGGACGCGAAGCCAGGACTATAAACTCGAGTTTATAGTCCTGGCTTCGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001014973.2-706s21c1
Sequence:GTACCGGTGGCACTCACCTACGAGTATTCTCGAGAATACTCGTAGGTGAGTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381387    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001014973.2-3277s21c1
Sequence:GTACCGGACATGGTTTGCTGCGTTATTTCTCGAGAAATAACGCAGCAAACCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001014973.1-3892s1c1
Sequence:CCGGGCCAAATACATTGTCCTTCTACTCGAGTAGAAGGACAATGTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014973.1-1981s1c1
Sequence:CCGGCGGCGTTATAGTGACTTCCATCTCGAGATGGAAGTCACTATAACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014973.1-2944s1c1
Sequence:CCGGCCACAGTATAAATTTCGTGAACTCGAGTTCACGAAATTTATACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014973.1-2865s1c1
Sequence:CCGGGTTTGAAATGTTTCAGCACAACTCGAGTTGTGCTGAAACATTTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014973.1-2299s1c1
Sequence:CCGGGCAGTCAAATCCCTTCCTGATCTCGAGATCAGGAAGGGATTTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001014973
VALIDATED
SNX13 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 13
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001014973.2-457s21c1
Sequence:GTACCGGACGCGAAGCCAGGACTATAAACTCGAGTTTATAGTCCTGGCTTCGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001014973.2-706s21c1
Sequence:GTACCGGTGGCACTCACCTACGAGTATTCTCGAGAATACTCGTAGGTGAGTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381387    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001014973.2-3277s21c1
Sequence:GTACCGGACATGGTTTGCTGCGTTATTTCTCGAGAAATAACGCAGCAAACCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001014973.1-3892s1c1
Sequence:CCGGGCCAAATACATTGTCCTTCTACTCGAGTAGAAGGACAATGTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014973.1-1981s1c1
Sequence:CCGGCGGCGTTATAGTGACTTCCATCTCGAGATGGAAGTCACTATAACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014973.1-2944s1c1
Sequence:CCGGCCACAGTATAAATTTCGTGAACTCGAGTTCACGAAATTTATACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014973.1-2865s1c1
Sequence:CCGGGTTTGAAATGTTTCAGCACAACTCGAGTTGTGCTGAAACATTTCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014973.1-2299s1c1
Sequence:CCGGGCAGTCAAATCCCTTCCTGATCTCGAGATCAGGAAGGGATTTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks