EMAIL THIS PAGE TO A FRIEND

SNX14

sorting nexin 14

Synonyms: RGS-PX2
Gene ID:
Human(57231) Summary: This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. The encoded protein also contains a regulator of G protein signaling (RGS) domain. Regulator of G protein signaling family members are regulatory molecules that act as GTPase activating proteins for G alpha subunits of heterotrimeric G proteins. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(244962) sorting nexin 14
Rat(315871) sorting nexin 14
cow(533801) sorting nexin 14
sheep(101116152) sorting nexin 14
naked mole-rat(101707532) sorting nexin 14
Domestic Rabbit(100343657) sorting nexin 14
Zebrafish(555970) sorting nexin 14
dog(474985) sorting nexin 14
Horse(100065533) sorting nexin 14
domestic cat(101087995) sorting nexin 14
chicken(421832) sorting nexin 14
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020468 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020468 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020468 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172926 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172926 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172926 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020468 Rosetta Predictions human pricing
NM_153816 Rosetta Predictions human pricing
NM_001108174 Rosetta Predictions rat pricing
NM_172926 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198906 predicted 2097
2 SASI_Hs01_00198907 predicted 2397
3 SASI_Hs01_00198908 predicted 1234
4 SASI_Hs01_00198909 predicted 1042
5 SASI_Hs02_00353544 predicted 2864
6 SASI_Hs01_00198910 predicted 2126
7 SASI_Hs01_00198912 predicted 2116
8 SASI_Hs01_00198913 predicted 1285
9 SASI_Hs01_00198914 predicted 1859
10 SASI_Hs02_00353545 predicted 2876
11 SASI_Hs01_00198911 predicted 934
12 SASI_Hs01_00198915 predicted 2972
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153816 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127718 predicted 2260
2 SASI_Hs01_00127719 predicted 2551
3 SASI_Hs01_00127720 predicted 1358
4 SASI_Hs01_00127721 predicted 1176
5 SASI_Hs02_00367495 predicted 3025
6 SASI_Hs01_00127722 predicted 2276
7 SASI_Hs01_00127724 predicted 2270
8 SASI_Hs01_00127725 predicted 1420
9 SASI_Hs01_00127726 predicted 2019
10 SASI_Hs02_00367496 predicted 3033
11 SASI_Hs01_00127723 predicted 1064
12 SASI_Hs01_00127727 predicted 3128
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108174 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236074 predicted 2079
2 SASI_Rn02_00236075 predicted 729
3 SASI_Rn02_00236076 predicted 2371
4 SASI_Rn02_00236077 predicted 1515
5 SASI_Rn02_00236078 predicted 867
6 SASI_Rn02_00236079 predicted 1300
7 SASI_Rn02_00236080 predicted 1406
8 SASI_Rn02_00236081 predicted 1319
9 SASI_Rn02_00236082 predicted 1599
10 SASI_Rn02_00236083 predicted 1540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172926 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176800 predicted 713
2 SASI_Mm01_00176801 predicted 1534
3 SASI_Mm01_00176802 predicted 1081
4 SASI_Mm02_00344933 predicted 712
5 SASI_Mm01_00176803 predicted 495
6 SASI_Mm01_00176804 predicted 1919
7 SASI_Mm01_00176805 predicted 1968
8 SASI_Mm01_00176806 predicted 849
9 SASI_Mm01_00176807 predicted 2477
10 SASI_Mm01_00176808 predicted 673
11 SASI_Mm01_00176809 predicted 761
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020468
VALIDATED
SNX14 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 14
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122237    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020468.2-3151s1c1
Sequence:CCGGGCAAACAGATAAGACTGATAACTCGAGTTATCAGTCTTATCTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020468.2-2126s1c1
Sequence:CCGGCCAGATGTAAATCTTGGGAAACTCGAGTTTCCCAAGATTTACATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020468.2-402s1c1
Sequence:CCGGGACCTGATTCTCTCTTACCAACTCGAGTTGGTAAGAGAGAATCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020468.2-1476s1c1
Sequence:CCGGCAGAATCACCAACACGCAATTCTCGAGAATTGCGTGTTGGTGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020468.2-2726s1c1
Sequence:CCGGGAAAGCATCAGACTTCTGTTTCTCGAGAAACAGAAGTCTGATGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_020468.2-2045s1c1
Sequence:CCGGCCAGAACTGAGTAATAGTCAACTCGAGTTGACTATTACTCAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020468.2-455s1c1
Sequence:CCGGCAGTTAGGACTTCAGGAATTACTCGAGTAATTCCTGAAGTCCTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_020468.2-1607s1c1
Sequence:CCGGCCTAATTATGGTGTAGCTGAACTCGAGTTCAGCTACACCATAATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_020468.2-404s1c1
Sequence:CCGGCCTGATTCTCTCTTACCAAATCTCGAGATTTGGTAAGAGAGAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020468.3-3043s21c1
Sequence:CCGGGATTGAGTCTCATAGTCTTTCCTCGAGGAAAGACTATGAGACTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020468.3-1436s21c1
Sequence:CCGGTGCCATAGTGATGAGTATTTCCTCGAGGAAATACTCATCACTATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020468.3-611s21c1
Sequence:CCGGGTGGATATTCCATCTATTATACTCGAGTATAATAGATGGAATATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020468.3-2581s21c1
Sequence:CCGGACTTCTCAGAGATGCTATATTCTCGAGAATATAGCATCTCTGAGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020468.3-1687s21c1
Sequence:CCGGGGCTGTGAGCACACCTAATACCTCGAGGTATTAGGTGTGCTCACAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020468
VALIDATED
SNX14 MISSION shRNA shRNA Plasmid DNA
sorting nexin 14
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122237    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020468.2-3151s1c1
Sequence:CCGGGCAAACAGATAAGACTGATAACTCGAGTTATCAGTCTTATCTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020468.2-2126s1c1
Sequence:CCGGCCAGATGTAAATCTTGGGAAACTCGAGTTTCCCAAGATTTACATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020468.2-402s1c1
Sequence:CCGGGACCTGATTCTCTCTTACCAACTCGAGTTGGTAAGAGAGAATCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020468.2-1476s1c1
Sequence:CCGGCAGAATCACCAACACGCAATTCTCGAGAATTGCGTGTTGGTGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020468.2-2726s1c1
Sequence:CCGGGAAAGCATCAGACTTCTGTTTCTCGAGAAACAGAAGTCTGATGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_020468.2-2045s1c1
Sequence:CCGGCCAGAACTGAGTAATAGTCAACTCGAGTTGACTATTACTCAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020468.2-455s1c1
Sequence:CCGGCAGTTAGGACTTCAGGAATTACTCGAGTAATTCCTGAAGTCCTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_020468.2-1607s1c1
Sequence:CCGGCCTAATTATGGTGTAGCTGAACTCGAGTTCAGCTACACCATAATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_020468.2-404s1c1
Sequence:CCGGCCTGATTCTCTCTTACCAAATCTCGAGATTTGGTAAGAGAGAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020468.3-3043s21c1
Sequence:CCGGGATTGAGTCTCATAGTCTTTCCTCGAGGAAAGACTATGAGACTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020468.3-1436s21c1
Sequence:CCGGTGCCATAGTGATGAGTATTTCCTCGAGGAAATACTCATCACTATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020468.3-611s21c1
Sequence:CCGGGTGGATATTCCATCTATTATACTCGAGTATAATAGATGGAATATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020468.3-2581s21c1
Sequence:CCGGACTTCTCAGAGATGCTATATTCTCGAGAATATAGCATCTCTGAGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020468.3-1687s21c1
Sequence:CCGGGGCTGTGAGCACACCTAATACCTCGAGGTATTAGGTGTGCTCACAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020468
VALIDATED
SNX14 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 14
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122237    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020468.2-3151s1c1
Sequence:CCGGGCAAACAGATAAGACTGATAACTCGAGTTATCAGTCTTATCTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020468.2-2126s1c1
Sequence:CCGGCCAGATGTAAATCTTGGGAAACTCGAGTTTCCCAAGATTTACATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020468.2-402s1c1
Sequence:CCGGGACCTGATTCTCTCTTACCAACTCGAGTTGGTAAGAGAGAATCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020468.2-1476s1c1
Sequence:CCGGCAGAATCACCAACACGCAATTCTCGAGAATTGCGTGTTGGTGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020468.2-2726s1c1
Sequence:CCGGGAAAGCATCAGACTTCTGTTTCTCGAGAAACAGAAGTCTGATGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_020468.2-2045s1c1
Sequence:CCGGCCAGAACTGAGTAATAGTCAACTCGAGTTGACTATTACTCAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020468.2-455s1c1
Sequence:CCGGCAGTTAGGACTTCAGGAATTACTCGAGTAATTCCTGAAGTCCTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_020468.2-1607s1c1
Sequence:CCGGCCTAATTATGGTGTAGCTGAACTCGAGTTCAGCTACACCATAATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_020468.2-404s1c1
Sequence:CCGGCCTGATTCTCTCTTACCAAATCTCGAGATTTGGTAAGAGAGAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434114    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020468.3-3043s21c1
Sequence:CCGGGATTGAGTCTCATAGTCTTTCCTCGAGGAAAGACTATGAGACTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020468.3-1436s21c1
Sequence:CCGGTGCCATAGTGATGAGTATTTCCTCGAGGAAATACTCATCACTATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020468.3-611s21c1
Sequence:CCGGGTGGATATTCCATCTATTATACTCGAGTATAATAGATGGAATATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020468.3-2581s21c1
Sequence:CCGGACTTCTCAGAGATGCTATATTCTCGAGAATATAGCATCTCTGAGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020468.3-1687s21c1
Sequence:CCGGGGCTGTGAGCACACCTAATACCTCGAGGTATTAGGTGTGCTCACAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172926
SNX14 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 14
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172926.1-1632s1c1
Sequence:CCGGCGTATTCAAGAGTACGACAATCTCGAGATTGTCGTACTCTTGAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172926.1-2460s1c1
Sequence:CCGGCGGAGTCTATGATTACCTGATCTCGAGATCAGGTAATCATAGACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172926.1-2884s1c1
Sequence:CCGGCCAGAGCTAAATAAGGTACAACTCGAGTTGTACCTTATTTAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172926.1-712s1c1
Sequence:CCGGGCAGCAATGAAACATATAGAACTCGAGTTCTATATGTTTCATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172926.2-1631s21c1
Sequence:CCGGCGTATTCAAGAGTACGACAATCTCGAGATTGTCGTACTCTTGAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172926.2-1359s21c1
Sequence:CCGGCCCTTCATTGTCGAAGAGATTCTCGAGAATCTCTTCGACAATGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172926.2-2459s21c1
Sequence:CCGGCGGAGTCTATGATTACCTGATCTCGAGATCAGGTAATCATAGACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172926.2-711s21c1
Sequence:CCGGGCAGCAATGAAACATATAGAACTCGAGTTCTATATGTTTCATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172926.2-2883s21c1
Sequence:CCGGCCAGAGCTAAATAAGGTACAACTCGAGTTGTACCTTATTTAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172926
SNX14 MISSION shRNA shRNA Plasmid DNA
sorting nexin 14
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172926.1-1632s1c1
Sequence:CCGGCGTATTCAAGAGTACGACAATCTCGAGATTGTCGTACTCTTGAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172926.1-2460s1c1
Sequence:CCGGCGGAGTCTATGATTACCTGATCTCGAGATCAGGTAATCATAGACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172926.1-2884s1c1
Sequence:CCGGCCAGAGCTAAATAAGGTACAACTCGAGTTGTACCTTATTTAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172926.1-712s1c1
Sequence:CCGGGCAGCAATGAAACATATAGAACTCGAGTTCTATATGTTTCATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172926.2-1631s21c1
Sequence:CCGGCGTATTCAAGAGTACGACAATCTCGAGATTGTCGTACTCTTGAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172926.2-1359s21c1
Sequence:CCGGCCCTTCATTGTCGAAGAGATTCTCGAGAATCTCTTCGACAATGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172926.2-2459s21c1
Sequence:CCGGCGGAGTCTATGATTACCTGATCTCGAGATCAGGTAATCATAGACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172926.2-711s21c1
Sequence:CCGGGCAGCAATGAAACATATAGAACTCGAGTTCTATATGTTTCATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172926.2-2883s21c1
Sequence:CCGGCCAGAGCTAAATAAGGTACAACTCGAGTTGTACCTTATTTAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172926
SNX14 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 14
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172926.1-1632s1c1
Sequence:CCGGCGTATTCAAGAGTACGACAATCTCGAGATTGTCGTACTCTTGAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172926.1-2460s1c1
Sequence:CCGGCGGAGTCTATGATTACCTGATCTCGAGATCAGGTAATCATAGACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172926.1-2884s1c1
Sequence:CCGGCCAGAGCTAAATAAGGTACAACTCGAGTTGTACCTTATTTAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172926.1-712s1c1
Sequence:CCGGGCAGCAATGAAACATATAGAACTCGAGTTCTATATGTTTCATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172926.2-1631s21c1
Sequence:CCGGCGTATTCAAGAGTACGACAATCTCGAGATTGTCGTACTCTTGAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172926.2-1359s21c1
Sequence:CCGGCCCTTCATTGTCGAAGAGATTCTCGAGAATCTCTTCGACAATGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172926.2-2459s21c1
Sequence:CCGGCGGAGTCTATGATTACCTGATCTCGAGATCAGGTAATCATAGACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172926.2-711s21c1
Sequence:CCGGGCAGCAATGAAACATATAGAACTCGAGTTCTATATGTTTCATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172926.2-2883s21c1
Sequence:CCGGCCAGAGCTAAATAAGGTACAACTCGAGTTGTACCTTATTTAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks