EMAIL THIS PAGE TO A FRIEND

SNX15

sorting nexin 15

Synonyms: HSAF001435
UniProtKB ID: Q9NRS6, Q9NRS5
Gene ID:
Human(29907) Summary: This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. Overexpression of this gene results in a decrease in the processing of insulin and hepatocyte growth factor receptors to their mature subunits. This decrease is caused by the mislocalization of furin, the endoprotease responsible for cleavage of insulin and hepatocyte growth factor receptors. This protein is involved in endosomal trafficking from the plasma membrane to recycling endosomes or the trans-Golgi network. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the upstream ADP-ribosylation factor-like 2 (ARL2) gene. [provided by RefSeq, Dec 2010]
Mouse(69024) sorting nexin 15
Rat(293691) sorting nexin 15
Zebrafish(393352) sorting nexin 15
domestic cat(101082093) sorting nexin 15
dog(612080) sorting nexin 15
naked mole-rat(101702424) sorting nexin 15
cow(507751) sorting nexin 15
Goat(100861118) sorting nexin 15
sheep(101119948) sorting nexin 15
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013306 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013306 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013306 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026912 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026912 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026912 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU041261 MISSION® esiRNA esiRNA targeting mouse Snx15 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013306 Rosetta Predictions human pricing
NM_147777 Rosetta Predictions human pricing
NM_001024752 Rosetta Predictions rat pricing
NM_026912 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013306 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025224 predicted 214
2 SASI_Hs01_00025225 predicted 230
3 SASI_Hs01_00025226 predicted 204
4 SASI_Hs01_00025227 predicted 246
5 SASI_Hs01_00025228 predicted 272
6 SASI_Hs01_00025229 predicted 248
7 SASI_Hs01_00025230 predicted 284
8 SASI_Hs01_00025231 predicted 244
9 SASI_Hs01_00025232 predicted 210
10 SASI_Hs01_00025233 predicted 279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147777 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068255 predicted 215
2 SASI_Hs01_00068256 predicted 235
3 SASI_Hs01_00068257 predicted 206
4 SASI_Hs01_00068258 predicted 248
5 SASI_Hs01_00068259 predicted 268
6 SASI_Hs01_00068260 predicted 251
7 SASI_Hs01_00068261 predicted 285
8 SASI_Hs01_00068262 predicted 244
9 SASI_Hs01_00068263 predicted 202
10 SASI_Hs01_00068264 predicted 284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024752 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083431 predicted 912
2 SASI_Rn01_00083432 predicted 222
3 SASI_Rn01_00083433 predicted 911
4 SASI_Rn01_00083434 predicted 239
5 SASI_Rn01_00083436 predicted 473
6 SASI_Rn01_00083437 predicted 791
7 SASI_Rn01_00083438 predicted 1068
8 SASI_Rn01_00083439 predicted 647
9 SASI_Rn02_00202627 predicted 648
10 SASI_Rn02_00202628 predicted 1211
11 SASI_Rn01_00083435 predicted 649
12 SASI_Rn01_00083440 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026912 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152011 predicted 772
2 SASI_Mm01_00152012 predicted 879
3 SASI_Mm01_00152013 predicted 200
4 SASI_Mm01_00152014 predicted 255
5 SASI_Mm01_00152015 predicted 755
6 SASI_Mm01_00152016 predicted 637
7 SASI_Mm01_00152017 predicted 889
8 SASI_Mm01_00152018 predicted 219
9 SASI_Mm01_00152019 predicted 892
10 SASI_Mm01_00152020 predicted 1053
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013306
VALIDATED
SNX15 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 15
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381912    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_013306.3-1305s21c1
Sequence:GTACCGGTGGAATCCAGGACTCACACTTCTCGAGAAGTGTGAGTCCTGGATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_013306.3-1112s21c1
Sequence:GTACCGGTCTCAACTCCCACCCTAACAGCTCGAGCTGTTAGGGTGGGAGTTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_013306.3-1202s21c1
Sequence:GTACCGGCCTACCTCCTGGTCTTGTAATCTCGAGATTACAAGACCAGGAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_013306.3-410s21c1
Sequence:CCGGCTTCGCTTCACTGTGCACATACTCGAGTATGTGCACAGTGAAGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013306.3-181s21c1
Sequence:CCGGGTACAAAGTAACCGCGCAGTTCTCGAGAACTGCGCGGTTACTTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013306.3-1042s21c1
Sequence:CCGGCCAGGAAGGTGTGAAGAAGAACTCGAGTTCTTCTTCACACCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_013306.3-193s21c1
Sequence:CCGGCGCGCAGTTCATCTCAAAGAACTCGAGTTCTTTGAGATGAACTGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013306.3-193s1c1
Sequence:CCGGCGCGCAGTTCATCTCAAAGAACTCGAGTTCTTTGAGATGAACTGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_013306.3-410s1c1
Sequence:CCGGCTTCGCTTCACTGTGCACATACTCGAGTATGTGCACAGTGAAGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_013306.3-1042s1c1
Sequence:CCGGCCAGGAAGGTGTGAAGAAGAACTCGAGTTCTTCTTCACACCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_013306.3-181s1c1
Sequence:CCGGGTACAAAGTAACCGCGCAGTTCTCGAGAACTGCGCGGTTACTTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013306
VALIDATED
SNX15 MISSION shRNA shRNA Plasmid DNA
sorting nexin 15
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381912    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_013306.3-1305s21c1
Sequence:GTACCGGTGGAATCCAGGACTCACACTTCTCGAGAAGTGTGAGTCCTGGATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_013306.3-1112s21c1
Sequence:GTACCGGTCTCAACTCCCACCCTAACAGCTCGAGCTGTTAGGGTGGGAGTTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_013306.3-1202s21c1
Sequence:GTACCGGCCTACCTCCTGGTCTTGTAATCTCGAGATTACAAGACCAGGAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_013306.3-410s21c1
Sequence:CCGGCTTCGCTTCACTGTGCACATACTCGAGTATGTGCACAGTGAAGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013306.3-181s21c1
Sequence:CCGGGTACAAAGTAACCGCGCAGTTCTCGAGAACTGCGCGGTTACTTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013306.3-1042s21c1
Sequence:CCGGCCAGGAAGGTGTGAAGAAGAACTCGAGTTCTTCTTCACACCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_013306.3-193s21c1
Sequence:CCGGCGCGCAGTTCATCTCAAAGAACTCGAGTTCTTTGAGATGAACTGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013306.3-193s1c1
Sequence:CCGGCGCGCAGTTCATCTCAAAGAACTCGAGTTCTTTGAGATGAACTGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_013306.3-410s1c1
Sequence:CCGGCTTCGCTTCACTGTGCACATACTCGAGTATGTGCACAGTGAAGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_013306.3-1042s1c1
Sequence:CCGGCCAGGAAGGTGTGAAGAAGAACTCGAGTTCTTCTTCACACCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_013306.3-181s1c1
Sequence:CCGGGTACAAAGTAACCGCGCAGTTCTCGAGAACTGCGCGGTTACTTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013306
VALIDATED
SNX15 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 15
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381912    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_013306.3-1305s21c1
Sequence:GTACCGGTGGAATCCAGGACTCACACTTCTCGAGAAGTGTGAGTCCTGGATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_013306.3-1112s21c1
Sequence:GTACCGGTCTCAACTCCCACCCTAACAGCTCGAGCTGTTAGGGTGGGAGTTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381774    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_013306.3-1202s21c1
Sequence:GTACCGGCCTACCTCCTGGTCTTGTAATCTCGAGATTACAAGACCAGGAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_013306.3-410s21c1
Sequence:CCGGCTTCGCTTCACTGTGCACATACTCGAGTATGTGCACAGTGAAGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013306.3-181s21c1
Sequence:CCGGGTACAAAGTAACCGCGCAGTTCTCGAGAACTGCGCGGTTACTTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013306.3-1042s21c1
Sequence:CCGGCCAGGAAGGTGTGAAGAAGAACTCGAGTTCTTCTTCACACCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_013306.3-193s21c1
Sequence:CCGGCGCGCAGTTCATCTCAAAGAACTCGAGTTCTTTGAGATGAACTGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013306.3-193s1c1
Sequence:CCGGCGCGCAGTTCATCTCAAAGAACTCGAGTTCTTTGAGATGAACTGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_013306.3-410s1c1
Sequence:CCGGCTTCGCTTCACTGTGCACATACTCGAGTATGTGCACAGTGAAGCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_013306.3-1042s1c1
Sequence:CCGGCCAGGAAGGTGTGAAGAAGAACTCGAGTTCTTCTTCACACCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_013306.3-181s1c1
Sequence:CCGGGTACAAAGTAACCGCGCAGTTCTCGAGAACTGCGCGGTTACTTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026912
VALIDATED
SNX15 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 15
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026912.1-252s21c1
Sequence:CCGGTTGGCCTATACTCACCGAAACCTCGAGGTTTCGGTGAGTATAGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317843    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026912.1-1184s21c1
Sequence:CCGGCCATATCTGTATTAACTGGATCTCGAGATCCAGTTAATACAGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026912.1-149s21c1
Sequence:CCGGGTACAAAGTAACCGCTCAGTTCTCGAGAACTGAGCGGTTACTTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026912.1-897s21c1
Sequence:CCGGACTCAAGCCCTGCGGAATGAACTCGAGTTCATTCCGCAGGGCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026912.1-190s21c1
Sequence:CCGGAGGATATCAAAGAGGTAGTAGCTCGAGCTACTACCTCTTTGATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093454    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026912.1-1184s1c1
Sequence:CCGGCCATATCTGTATTAACTGGATCTCGAGATCCAGTTAATACAGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026912.1-251s1c1
Sequence:CCGGCTTGGCCTATACTCACCGAAACTCGAGTTTCGGTGAGTATAGGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026912.1-134s1c1
Sequence:CCGGCAAGGGTTACACAGAGTACAACTCGAGTTGTACTCTGTGTAACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026912.1-149s1c1
Sequence:CCGGGTACAAAGTAACCGCTCAGTTCTCGAGAACTGAGCGGTTACTTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026912
VALIDATED
SNX15 MISSION shRNA shRNA Plasmid DNA
sorting nexin 15
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026912.1-252s21c1
Sequence:CCGGTTGGCCTATACTCACCGAAACCTCGAGGTTTCGGTGAGTATAGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317843    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026912.1-1184s21c1
Sequence:CCGGCCATATCTGTATTAACTGGATCTCGAGATCCAGTTAATACAGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026912.1-149s21c1
Sequence:CCGGGTACAAAGTAACCGCTCAGTTCTCGAGAACTGAGCGGTTACTTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026912.1-897s21c1
Sequence:CCGGACTCAAGCCCTGCGGAATGAACTCGAGTTCATTCCGCAGGGCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026912.1-190s21c1
Sequence:CCGGAGGATATCAAAGAGGTAGTAGCTCGAGCTACTACCTCTTTGATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093454    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026912.1-1184s1c1
Sequence:CCGGCCATATCTGTATTAACTGGATCTCGAGATCCAGTTAATACAGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026912.1-251s1c1
Sequence:CCGGCTTGGCCTATACTCACCGAAACTCGAGTTTCGGTGAGTATAGGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026912.1-134s1c1
Sequence:CCGGCAAGGGTTACACAGAGTACAACTCGAGTTGTACTCTGTGTAACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026912.1-149s1c1
Sequence:CCGGGTACAAAGTAACCGCTCAGTTCTCGAGAACTGAGCGGTTACTTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026912
VALIDATED
SNX15 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 15
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026912.1-252s21c1
Sequence:CCGGTTGGCCTATACTCACCGAAACCTCGAGGTTTCGGTGAGTATAGGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317843    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026912.1-1184s21c1
Sequence:CCGGCCATATCTGTATTAACTGGATCTCGAGATCCAGTTAATACAGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026912.1-149s21c1
Sequence:CCGGGTACAAAGTAACCGCTCAGTTCTCGAGAACTGAGCGGTTACTTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026912.1-897s21c1
Sequence:CCGGACTCAAGCCCTGCGGAATGAACTCGAGTTCATTCCGCAGGGCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026912.1-190s21c1
Sequence:CCGGAGGATATCAAAGAGGTAGTAGCTCGAGCTACTACCTCTTTGATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093454    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026912.1-1184s1c1
Sequence:CCGGCCATATCTGTATTAACTGGATCTCGAGATCCAGTTAATACAGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026912.1-251s1c1
Sequence:CCGGCTTGGCCTATACTCACCGAAACTCGAGTTTCGGTGAGTATAGGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026912.1-134s1c1
Sequence:CCGGCAAGGGTTACACAGAGTACAACTCGAGTTGTACTCTGTGTAACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026912.1-149s1c1
Sequence:CCGGGTACAAAGTAACCGCTCAGTTCTCGAGAACTGAGCGGTTACTTTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks