EMAIL THIS PAGE TO A FRIEND

SNX16

sorting nexin 16

UniProtKB ID: P57768, A8K4D8, Q658L0, Q8N4U3
Gene ID:
Human(64089) Summary: This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. The function of this protein has not been determined. This gene results in three transcript variants encoding two distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(74718) sorting nexin 16
Rat(64088) sorting nexin 16
cow(507462) sorting nexin 16
sheep(101119227) sorting nexin 16
naked mole-rat(101703205) sorting nexin 16
fruit fly(37015) Sorting nexin 16
domestic cat(101092335) sorting nexin 16
Zebrafish(402964) sorting nexin 16
chicken(420202) sorting nexin 16
dog(487019) sorting nexin 16
233 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029068 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029068 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029068 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152836 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152836 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152836 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022133 Rosetta Predictions human pricing
NM_152836 Rosetta Predictions human pricing
NM_152837 Rosetta Predictions human pricing
NM_022289 Rosetta Predictions rat pricing
NM_001127191 Rosetta Predictions mouse pricing
NM_029068 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022133 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106906 predicted 1208
2 SASI_Hs01_00106907 predicted 462
3 SASI_Hs01_00106908 predicted 468
4 SASI_Hs02_00355538 predicted 464
5 SASI_Hs01_00106909 predicted 1360
6 SASI_Hs01_00106910 predicted 1154
7 SASI_Hs01_00106911 predicted 1121
8 SASI_Hs01_00106913 predicted 1271
9 SASI_Hs01_00106914 predicted 1194
10 SASI_Hs02_00355539 predicted 451
11 SASI_Hs01_00106912 predicted 1129
12 SASI_Hs01_00106915 predicted 1030
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131137 predicted 1042
2 SASI_Hs01_00131138 predicted 296
3 SASI_Hs01_00131139 predicted 310
4 SASI_Hs02_00366769 predicted 300
5 SASI_Hs01_00131140 predicted 1194
6 SASI_Hs01_00131141 predicted 986
7 SASI_Hs01_00131142 predicted 957
8 SASI_Hs01_00131144 predicted 1101
9 SASI_Hs01_00131145 predicted 1031
10 SASI_Hs02_00366770 predicted 281
11 SASI_Hs01_00131143 predicted 970
12 SASI_Hs01_00131146 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152837 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171413 predicted 952
2 SASI_Hs01_00171414 predicted 295
3 SASI_Hs01_00171415 predicted 304
4 SASI_Hs02_00366771 predicted 291
5 SASI_Hs01_00171416 predicted 1106
6 SASI_Hs01_00171417 predicted 898
7 SASI_Hs01_00171418 predicted 867
8 SASI_Hs01_00171420 predicted 1016
9 SASI_Hs01_00171421 predicted 940
10 SASI_Hs02_00366772 predicted 283
11 SASI_Hs01_00171419 predicted 883
12 SASI_Hs01_00171422 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022289 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051178 predicted 1119
2 SASI_Rn01_00051179 predicted 524
3 SASI_Rn01_00051180 predicted 1223
4 SASI_Rn02_00263107 predicted 798
5 SASI_Rn01_00051182 predicted 1409
6 SASI_Rn01_00051183 predicted 426
7 SASI_Rn01_00051184 predicted 386
8 SASI_Rn01_00051185 predicted 402
9 SASI_Rn01_00051186 predicted 689
10 SASI_Rn01_00051187 predicted 1081
11 SASI_Rn01_00051181 predicted 856
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127191 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310127 predicted 330
2 SASI_Mm02_00310128 predicted 739
3 SASI_Mm02_00310129 predicted 450
4 SASI_Mm02_00310130 predicted 859
5 SASI_Mm02_00310131 predicted 671
6 SASI_Mm02_00310132 predicted 549
7 SASI_Mm02_00310133 predicted 521
8 SASI_Mm02_00310134 predicted 710
9 SASI_Mm02_00310135 predicted 505
10 SASI_Mm02_00310136 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029068 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334823 predicted 330
2 SASI_Mm01_00109307 predicted 737
3 SASI_Mm01_00109310 predicted 458
4 SASI_Mm01_00109311 predicted 865
5 SASI_Mm02_00334824 predicted 670
6 SASI_Mm01_00109314 predicted 553
7 SASI_Mm01_00109315 predicted 528
8 SASI_Mm02_00334825 predicted 712
9 SASI_Mm02_00334826 predicted 499
10 SASI_Mm02_00334827 predicted 421
11 SASI_Mm01_00109306 predicted 976
12 SASI_Mm01_00109308 predicted 1164
13 SASI_Mm01_00109309 predicted 1075
14 SASI_Mm01_00109312 predicted 1059
15 SASI_Mm01_00109313 predicted 807
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029068
VALIDATED
SNX16 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 16
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029068.2-1269s1c1
Sequence:CCGGGAAGTCGCACAGTTGGCATATCTCGAGATATGCCAACTGTGCGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029068.2-1671s1c1
Sequence:CCGGGCATGTTAGAATCTGGATAATCTCGAGATTATCCAGATTCTAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029068.2-323s1c1
Sequence:CCGGCAGCTTTACAAACAACAGAAACTCGAGTTTCTGTTGTTTGTAAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029068.2-1898s1c1
Sequence:CCGGGCCTTGATTCAAGTGATGATTCTCGAGAATCATCACTTGAATCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029068.2-975s1c1
Sequence:CCGGGAGACTAACTACCATTTACAACTCGAGTTGTAAATGGTAGTTAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029068.3-1239s21c1
Sequence:CCGGAGAATCTAGAGCTGATCATAACTCGAGTTATGATCAGCTCTAGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277591    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029068.3-1708s21c1
Sequence:CCGGGCATGTTAGAATCTGGATAATCTCGAGATTATCCAGATTCTAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029068.3-1308s21c1
Sequence:CCGGAGTCGCACAGTTGGCATATAACTCGAGTTATATGCCAACTGTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029068.3-626s1c1
Sequence:CCGGGACCTTCAACACCTACAATTCCTCGAGGAATTGTAGGTGTTGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029068.3-548s1c1
Sequence:CCGGCAGATTCATCCATTGAGTATTCTCGAGAATACTCAATGGATGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029068.3-519s21c1
Sequence:CCGGTCCTCTCATTAGGACTAAATTCTCGAGAATTTAGTCCTAATGAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029068.3-1935s21c1
Sequence:CCGGGCCTTGATTCAAGTGATGATTCTCGAGAATCATCACTTGAATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029068.3-1012s21c1
Sequence:CCGGGAGACTAACTACCATTTACAACTCGAGTTGTAAATGGTAGTTAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029068
VALIDATED
SNX16 MISSION shRNA shRNA Plasmid DNA
sorting nexin 16
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029068.2-1269s1c1
Sequence:CCGGGAAGTCGCACAGTTGGCATATCTCGAGATATGCCAACTGTGCGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029068.2-1671s1c1
Sequence:CCGGGCATGTTAGAATCTGGATAATCTCGAGATTATCCAGATTCTAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029068.2-323s1c1
Sequence:CCGGCAGCTTTACAAACAACAGAAACTCGAGTTTCTGTTGTTTGTAAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029068.2-1898s1c1
Sequence:CCGGGCCTTGATTCAAGTGATGATTCTCGAGAATCATCACTTGAATCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029068.2-975s1c1
Sequence:CCGGGAGACTAACTACCATTTACAACTCGAGTTGTAAATGGTAGTTAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029068.3-1239s21c1
Sequence:CCGGAGAATCTAGAGCTGATCATAACTCGAGTTATGATCAGCTCTAGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277591    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029068.3-1708s21c1
Sequence:CCGGGCATGTTAGAATCTGGATAATCTCGAGATTATCCAGATTCTAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029068.3-1308s21c1
Sequence:CCGGAGTCGCACAGTTGGCATATAACTCGAGTTATATGCCAACTGTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029068.3-626s1c1
Sequence:CCGGGACCTTCAACACCTACAATTCCTCGAGGAATTGTAGGTGTTGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029068.3-548s1c1
Sequence:CCGGCAGATTCATCCATTGAGTATTCTCGAGAATACTCAATGGATGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029068.3-519s21c1
Sequence:CCGGTCCTCTCATTAGGACTAAATTCTCGAGAATTTAGTCCTAATGAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029068.3-1935s21c1
Sequence:CCGGGCCTTGATTCAAGTGATGATTCTCGAGAATCATCACTTGAATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029068.3-1012s21c1
Sequence:CCGGGAGACTAACTACCATTTACAACTCGAGTTGTAAATGGTAGTTAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029068
VALIDATED
SNX16 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 16
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029068.2-1269s1c1
Sequence:CCGGGAAGTCGCACAGTTGGCATATCTCGAGATATGCCAACTGTGCGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176841    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029068.2-1671s1c1
Sequence:CCGGGCATGTTAGAATCTGGATAATCTCGAGATTATCCAGATTCTAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029068.2-323s1c1
Sequence:CCGGCAGCTTTACAAACAACAGAAACTCGAGTTTCTGTTGTTTGTAAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177205    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029068.2-1898s1c1
Sequence:CCGGGCCTTGATTCAAGTGATGATTCTCGAGAATCATCACTTGAATCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029068.2-975s1c1
Sequence:CCGGGAGACTAACTACCATTTACAACTCGAGTTGTAAATGGTAGTTAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029068.3-1239s21c1
Sequence:CCGGAGAATCTAGAGCTGATCATAACTCGAGTTATGATCAGCTCTAGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277591    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029068.3-1708s21c1
Sequence:CCGGGCATGTTAGAATCTGGATAATCTCGAGATTATCCAGATTCTAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029068.3-1308s21c1
Sequence:CCGGAGTCGCACAGTTGGCATATAACTCGAGTTATATGCCAACTGTGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029068.3-626s1c1
Sequence:CCGGGACCTTCAACACCTACAATTCCTCGAGGAATTGTAGGTGTTGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029068.3-548s1c1
Sequence:CCGGCAGATTCATCCATTGAGTATTCTCGAGAATACTCAATGGATGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029068.3-519s21c1
Sequence:CCGGTCCTCTCATTAGGACTAAATTCTCGAGAATTTAGTCCTAATGAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277518    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029068.3-1935s21c1
Sequence:CCGGGCCTTGATTCAAGTGATGATTCTCGAGAATCATCACTTGAATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029068.3-1012s21c1
Sequence:CCGGGAGACTAACTACCATTTACAACTCGAGTTGTAAATGGTAGTTAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152836
VALIDATED
SNX16 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 16
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152836.1-853s1c1
Sequence:CCGGCAGGGCATTCTGTGAAACTTTCTCGAGAAAGTTTCACAGAATGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152836.1-2469s1c1
Sequence:CCGGCCAGTCGGTATGCTTTCTAAACTCGAGTTTAGAAAGCATACCGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147926    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152836.1-2206s1c1
Sequence:CCGGGCCAAGTTTAATTGGTGGATTCTCGAGAATCCACCAATTAAACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152836.1-1585s1c1
Sequence:CCGGGCATGTTACTATCTGGGTGATCTCGAGATCACCCAGATAGTAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_152836.1-267s1c1
Sequence:CCGGGCAGTGTCTCAACAAGCTCAACTCGAGTTGAGCTTGTTGAGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152836.1-875s1c1
Sequence:CCGGGAAGAGACAAACTACCGCTTACTCGAGTAAGCGGTAGTTTGTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152836.2-423s21c1
Sequence:CCGGGACAAGTGTTCCTGATCAAATCTCGAGATTTGATCAGGAACACTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152836.2-1675s21c1
Sequence:CCGGGTTACTATCTGGGTGATATATCTCGAGATATATCACCCAGATAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360147    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152836.2-1705s21c1
Sequence:CCGGTATCTCTGACATGACATATTTCTCGAGAAATATGTCATGTCAGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152836.2-396s21c1
Sequence:CCGGAGACTCAAATATGGGTAATTTCTCGAGAAATTACCCATATTTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152836
VALIDATED
SNX16 MISSION shRNA shRNA Plasmid DNA
sorting nexin 16
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152836.1-853s1c1
Sequence:CCGGCAGGGCATTCTGTGAAACTTTCTCGAGAAAGTTTCACAGAATGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152836.1-2469s1c1
Sequence:CCGGCCAGTCGGTATGCTTTCTAAACTCGAGTTTAGAAAGCATACCGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147926    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152836.1-2206s1c1
Sequence:CCGGGCCAAGTTTAATTGGTGGATTCTCGAGAATCCACCAATTAAACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152836.1-1585s1c1
Sequence:CCGGGCATGTTACTATCTGGGTGATCTCGAGATCACCCAGATAGTAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_152836.1-267s1c1
Sequence:CCGGGCAGTGTCTCAACAAGCTCAACTCGAGTTGAGCTTGTTGAGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152836.1-875s1c1
Sequence:CCGGGAAGAGACAAACTACCGCTTACTCGAGTAAGCGGTAGTTTGTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152836.2-423s21c1
Sequence:CCGGGACAAGTGTTCCTGATCAAATCTCGAGATTTGATCAGGAACACTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152836.2-1675s21c1
Sequence:CCGGGTTACTATCTGGGTGATATATCTCGAGATATATCACCCAGATAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360147    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152836.2-1705s21c1
Sequence:CCGGTATCTCTGACATGACATATTTCTCGAGAAATATGTCATGTCAGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152836.2-396s21c1
Sequence:CCGGAGACTCAAATATGGGTAATTTCTCGAGAAATTACCCATATTTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152836
VALIDATED
SNX16 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 16
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152836.1-853s1c1
Sequence:CCGGCAGGGCATTCTGTGAAACTTTCTCGAGAAAGTTTCACAGAATGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152836.1-2469s1c1
Sequence:CCGGCCAGTCGGTATGCTTTCTAAACTCGAGTTTAGAAAGCATACCGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147926    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152836.1-2206s1c1
Sequence:CCGGGCCAAGTTTAATTGGTGGATTCTCGAGAATCCACCAATTAAACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130391    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152836.1-1585s1c1
Sequence:CCGGGCATGTTACTATCTGGGTGATCTCGAGATCACCCAGATAGTAACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A3
TRC Version: 1 Clone ID:NM_152836.1-267s1c1
Sequence:CCGGGCAGTGTCTCAACAAGCTCAACTCGAGTTGAGCTTGTTGAGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_152836.1-875s1c1
Sequence:CCGGGAAGAGACAAACTACCGCTTACTCGAGTAAGCGGTAGTTTGTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152836.2-423s21c1
Sequence:CCGGGACAAGTGTTCCTGATCAAATCTCGAGATTTGATCAGGAACACTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152836.2-1675s21c1
Sequence:CCGGGTTACTATCTGGGTGATATATCTCGAGATATATCACCCAGATAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360147    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152836.2-1705s21c1
Sequence:CCGGTATCTCTGACATGACATATTTCTCGAGAAATATGTCATGTCAGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152836.2-396s21c1
Sequence:CCGGAGACTCAAATATGGGTAATTTCTCGAGAAATTACCCATATTTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks