EMAIL THIS PAGE TO A FRIEND

SNX17

sorting nexin 17

UniProtKB ID: Q15036, B4DQM7, Q53HN7, Q6IAS3
Gene ID:
Human(9784) Summary: This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like some family members, but contains a B41 domain. This protein interacts with the cytoplasmic domain of P-selectin, and may function in the intracellular trafficking of P-selectin. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2012]
Mouse(266781) sorting nexin 17
Rat(298836) sorting nexin 17
Zebrafish(568263) sorting nexin 17
Horse(100055239) sorting nexin 17
domestic cat(101097475) sorting nexin 17
chicken(421990) sorting nexin 17
dog(483011) sorting nexin 17
naked mole-rat(101714437) sorting nexin 17
Domestic Rabbit(100351476) sorting nexin 17
cow(529972) sorting nexin 17
sheep(101117487) sorting nexin 17
116 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153680 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153680 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153680 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014748 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014748 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014748 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014748 Rosetta Predictions human pricing
NM_001011981 Rosetta Predictions rat pricing
XM_575995 Rosetta Predictions rat pricing
NM_153680 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014748 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073431 predicted 886
2 SASI_Hs01_00073432 predicted 459
3 SASI_Hs01_00073433 predicted 283
4 SASI_Hs01_00073434 predicted 1578
5 SASI_Hs01_00073435 predicted 614
6 SASI_Hs01_00073438 predicted 678
7 SASI_Hs01_00073439 predicted 1513
8 SASI_Hs01_00073440 predicted 1494
9 SASI_Hs02_00346212 predicted 376
10 SASI_Hs02_00346213 predicted 1373
11 SASI_Hs01_00073436 predicted 844
12 SASI_Hs01_00073437 predicted 451
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011981 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087682 predicted 344
2 SASI_Rn02_00200007 predicted 1036
3 SASI_Rn01_00087683 predicted 1377
4 SASI_Rn01_00087684 predicted 391
5 SASI_Rn01_00087685 predicted 500
6 SASI_Rn01_00087686 predicted 401
7 SASI_Rn01_00087690 predicted 364
8 SASI_Rn01_00087691 predicted 645
9 SASI_Rn02_00200008 predicted 1396
10 SASI_Rn02_00200009 predicted 1609
11 SASI_Rn01_00087687 predicted 1393
12 SASI_Rn01_00087688 predicted 696
13 SASI_Rn01_00087689 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575995 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00158848 predicted 877
2 SASI_Rn01_00158849 predicted 822
3 SASI_Rn01_00158850 predicted 723
4 SASI_Rn01_00158851 predicted 916
5 SASI_Rn01_00158852 predicted 915
6 SASI_Rn01_00158853 predicted 701
7 SASI_Rn01_00158854 predicted 825
8 SASI_Rn01_00158855 predicted 741
9 SASI_Rn01_00158856 predicted 510
10 SASI_Rn01_00158857 predicted 946
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153680 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087723 predicted 489
2 SASI_Mm01_00087724 predicted 341
3 SASI_Mm01_00087726 predicted 1389
4 SASI_Mm01_00087727 predicted 681
5 SASI_Mm02_00343465 predicted 635
6 SASI_Mm01_00087728 predicted 491
7 SASI_Mm02_00343466 predicted 705
8 SASI_Mm01_00087729 predicted 1031
9 SASI_Mm01_00087730 predicted 549
10 SASI_Mm01_00087731 predicted 482
11 SASI_Mm01_00087722 predicted 394
12 SASI_Mm01_00087725 predicted 645
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153680
VALIDATED
SNX17 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 17
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153680.2-754s21c1
Sequence:GTACCGGGTTGGCCTGAACCTGCTTTATCTCGAGATAAAGCAGGTTCAGGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153680.2-556s21c1
Sequence:CCGGCCAGATGACTTGATCGGATATCTCGAGATATCCGATCAAGTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153680.2-1535s21c1
Sequence:CCGGCCTCTACCTGAGAGGAGATTTCTCGAGAAATCTCCTCTCAGGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153680.2-1615s21c1
Sequence:CCGGCCACTTCTCCTTGTTCCTCTTCTCGAGAAGAGGAACAAGGAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153680.2-923s21c1
Sequence:CCGGATGCCTGTGTGGCTGACTTTCCTCGAGGAAAGTCAGCCACACAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153680.2-1384s21c1
Sequence:GTACCGGATGGTGAAACTCTCAAGTAAACTCGAGTTTACTTGAGAGTTTCACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153680.1-1615s1c1
Sequence:CCGGCCACTTCTCCTTGTTCCTCTTCTCGAGAAGAGGAACAAGGAGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153680.1-1535s1c1
Sequence:CCGGCCTCTACCTGAGAGGAGATTTCTCGAGAAATCTCCTCTCAGGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153680.1-556s1c1
Sequence:CCGGCCAGATGACTTGATCGGATATCTCGAGATATCCGATCAAGTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153680
VALIDATED
SNX17 MISSION shRNA shRNA Plasmid DNA
sorting nexin 17
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153680.2-754s21c1
Sequence:GTACCGGGTTGGCCTGAACCTGCTTTATCTCGAGATAAAGCAGGTTCAGGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153680.2-556s21c1
Sequence:CCGGCCAGATGACTTGATCGGATATCTCGAGATATCCGATCAAGTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153680.2-1535s21c1
Sequence:CCGGCCTCTACCTGAGAGGAGATTTCTCGAGAAATCTCCTCTCAGGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153680.2-1615s21c1
Sequence:CCGGCCACTTCTCCTTGTTCCTCTTCTCGAGAAGAGGAACAAGGAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153680.2-923s21c1
Sequence:CCGGATGCCTGTGTGGCTGACTTTCCTCGAGGAAAGTCAGCCACACAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153680.2-1384s21c1
Sequence:GTACCGGATGGTGAAACTCTCAAGTAAACTCGAGTTTACTTGAGAGTTTCACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153680.1-1615s1c1
Sequence:CCGGCCACTTCTCCTTGTTCCTCTTCTCGAGAAGAGGAACAAGGAGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153680.1-1535s1c1
Sequence:CCGGCCTCTACCTGAGAGGAGATTTCTCGAGAAATCTCCTCTCAGGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153680.1-556s1c1
Sequence:CCGGCCAGATGACTTGATCGGATATCTCGAGATATCCGATCAAGTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153680
VALIDATED
SNX17 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 17
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153680.2-754s21c1
Sequence:GTACCGGGTTGGCCTGAACCTGCTTTATCTCGAGATAAAGCAGGTTCAGGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153680.2-556s21c1
Sequence:CCGGCCAGATGACTTGATCGGATATCTCGAGATATCCGATCAAGTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153680.2-1535s21c1
Sequence:CCGGCCTCTACCTGAGAGGAGATTTCTCGAGAAATCTCCTCTCAGGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153680.2-1615s21c1
Sequence:CCGGCCACTTCTCCTTGTTCCTCTTCTCGAGAAGAGGAACAAGGAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153680.2-923s21c1
Sequence:CCGGATGCCTGTGTGGCTGACTTTCCTCGAGGAAAGTCAGCCACACAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153680.2-1384s21c1
Sequence:GTACCGGATGGTGAAACTCTCAAGTAAACTCGAGTTTACTTGAGAGTTTCACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153680.1-1615s1c1
Sequence:CCGGCCACTTCTCCTTGTTCCTCTTCTCGAGAAGAGGAACAAGGAGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153680.1-1535s1c1
Sequence:CCGGCCTCTACCTGAGAGGAGATTTCTCGAGAAATCTCCTCTCAGGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153680.1-556s1c1
Sequence:CCGGCCAGATGACTTGATCGGATATCTCGAGATATCCGATCAAGTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014748
VALIDATED
SNX17 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 17
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_014748.2-278s21c1
Sequence:GTACCGGCCTACGTGGCCTATAACATTCCTCGAGGAATGTTATAGGCCACGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014748.2-1582s21c1
Sequence:GTACCGGAGTGATGTCCACGGCAATTTCCTCGAGGAAATTGCCGTGGACATCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_014748.2-794s21c1
Sequence:CCGGGCCTTCGGAGTCAAGAGTATACTCGAGTATACTCTTGACTCCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014748.2-1505s21c1
Sequence:CCGGCTATGGTCAAACTCTCAAGTACTCGAGTACTTGAGAGTTTGACCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014748.2-504s21c1
Sequence:CCGGCAGCGAGACTTTCAACAGTTTCTCGAGAAACTGTTGAAAGTCTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_014748.2-690s21c1
Sequence:CCGGGATTGGATACTTTAGTCTATTCTCGAGAATAGACTAAAGTATCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014748.2-1848s21c1
Sequence:CCGGTCGATGCCAAATTAGCATTTACTCGAGTAAATGCTAATTTGGCATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381366    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_014748.2-1772s21c1
Sequence:GTACCGGGCCTCGTATCCTACCTTTCCTCTCGAGAGGAAAGGTAGGATACGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014748.2-749s21c1
Sequence:GTACCGGTACGGAAGTTGCAAGAGTTTGCTCGAGCAAACTCTTGCAACTTCCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_014748.2-286s1c1
Sequence:CCGGGCCTATAACATTCACGTGAATCTCGAGATTCACGTGAATGTTATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014748.2-1505s1c1
Sequence:CCGGCTATGGTCAAACTCTCAAGTACTCGAGTACTTGAGAGTTTGACCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014748.2-504s1c1
Sequence:CCGGCAGCGAGACTTTCAACAGTTTCTCGAGAAACTGTTGAAAGTCTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_014748.2-1323s1c1
Sequence:CCGGCCAGGCTATCATGATGAGCATCTCGAGATGCTCATCATGATAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014748.2-794s1c1
Sequence:CCGGGCCTTCGGAGTCAAGAGTATACTCGAGTATACTCTTGACTCCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014748
VALIDATED
SNX17 MISSION shRNA shRNA Plasmid DNA
sorting nexin 17
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_014748.2-278s21c1
Sequence:GTACCGGCCTACGTGGCCTATAACATTCCTCGAGGAATGTTATAGGCCACGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014748.2-1582s21c1
Sequence:GTACCGGAGTGATGTCCACGGCAATTTCCTCGAGGAAATTGCCGTGGACATCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_014748.2-794s21c1
Sequence:CCGGGCCTTCGGAGTCAAGAGTATACTCGAGTATACTCTTGACTCCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014748.2-1505s21c1
Sequence:CCGGCTATGGTCAAACTCTCAAGTACTCGAGTACTTGAGAGTTTGACCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014748.2-504s21c1
Sequence:CCGGCAGCGAGACTTTCAACAGTTTCTCGAGAAACTGTTGAAAGTCTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_014748.2-690s21c1
Sequence:CCGGGATTGGATACTTTAGTCTATTCTCGAGAATAGACTAAAGTATCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014748.2-1848s21c1
Sequence:CCGGTCGATGCCAAATTAGCATTTACTCGAGTAAATGCTAATTTGGCATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381366    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_014748.2-1772s21c1
Sequence:GTACCGGGCCTCGTATCCTACCTTTCCTCTCGAGAGGAAAGGTAGGATACGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014748.2-749s21c1
Sequence:GTACCGGTACGGAAGTTGCAAGAGTTTGCTCGAGCAAACTCTTGCAACTTCCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_014748.2-286s1c1
Sequence:CCGGGCCTATAACATTCACGTGAATCTCGAGATTCACGTGAATGTTATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014748.2-1505s1c1
Sequence:CCGGCTATGGTCAAACTCTCAAGTACTCGAGTACTTGAGAGTTTGACCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014748.2-504s1c1
Sequence:CCGGCAGCGAGACTTTCAACAGTTTCTCGAGAAACTGTTGAAAGTCTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_014748.2-1323s1c1
Sequence:CCGGCCAGGCTATCATGATGAGCATCTCGAGATGCTCATCATGATAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014748.2-794s1c1
Sequence:CCGGGCCTTCGGAGTCAAGAGTATACTCGAGTATACTCTTGACTCCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014748
VALIDATED
SNX17 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 17
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_014748.2-278s21c1
Sequence:GTACCGGCCTACGTGGCCTATAACATTCCTCGAGGAATGTTATAGGCCACGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014748.2-1582s21c1
Sequence:GTACCGGAGTGATGTCCACGGCAATTTCCTCGAGGAAATTGCCGTGGACATCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_014748.2-794s21c1
Sequence:CCGGGCCTTCGGAGTCAAGAGTATACTCGAGTATACTCTTGACTCCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014748.2-1505s21c1
Sequence:CCGGCTATGGTCAAACTCTCAAGTACTCGAGTACTTGAGAGTTTGACCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014748.2-504s21c1
Sequence:CCGGCAGCGAGACTTTCAACAGTTTCTCGAGAAACTGTTGAAAGTCTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_014748.2-690s21c1
Sequence:CCGGGATTGGATACTTTAGTCTATTCTCGAGAATAGACTAAAGTATCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_014748.2-1848s21c1
Sequence:CCGGTCGATGCCAAATTAGCATTTACTCGAGTAAATGCTAATTTGGCATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381366    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_014748.2-1772s21c1
Sequence:GTACCGGGCCTCGTATCCTACCTTTCCTCTCGAGAGGAAAGGTAGGATACGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014748.2-749s21c1
Sequence:GTACCGGTACGGAAGTTGCAAGAGTTTGCTCGAGCAAACTCTTGCAACTTCCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_014748.2-286s1c1
Sequence:CCGGGCCTATAACATTCACGTGAATCTCGAGATTCACGTGAATGTTATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014748.2-1505s1c1
Sequence:CCGGCTATGGTCAAACTCTCAAGTACTCGAGTACTTGAGAGTTTGACCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014748.2-504s1c1
Sequence:CCGGCAGCGAGACTTTCAACAGTTTCTCGAGAAACTGTTGAAAGTCTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_014748.2-1323s1c1
Sequence:CCGGCCAGGCTATCATGATGAGCATCTCGAGATGCTCATCATGATAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014748.2-794s1c1
Sequence:CCGGGCCTTCGGAGTCAAGAGTATACTCGAGTATACTCTTGACTCCGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks