EMAIL THIS PAGE TO A FRIEND

SNX18

sorting nexin 18

Synonyms: SH3PX2 SH3PXD3B SNAG1
UniProtKB ID: Q96RF0, B4E2B3, H7BXX3, Q05BB3, Q0VG02
Gene ID:
Human(112574) Summary: This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like some family members, but contains a SH3 domain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(170625) sorting nexin 18
Rat(310097) sorting nexin 18
cow(538366) sorting nexin 18
sheep(101113793) sorting nexin 18
naked mole-rat(101698223) sorting nexin 18
chicken(768969) sorting nexin 18
dog(610530) sorting nexin 18
domestic cat(101089494) sorting nexin 18
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130796 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130796 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130796 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052870 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052870 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052870 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102575 Rosetta Predictions human pricing
NM_052870 Rosetta Predictions human pricing
NM_001107652 Rosetta Predictions rat pricing
NM_130796 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102575 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323263 predicted 1220
2 SASI_Hs02_00323264 predicted 1542
3 SASI_Hs02_00323265 predicted 1247
4 SASI_Hs02_00323266 predicted 636
5 SASI_Hs02_00323267 predicted 1534
6 SASI_Hs02_00323268 predicted 1105
7 SASI_Hs02_00323269 predicted 1526
8 SASI_Hs02_00323270 predicted 1049
9 SASI_Hs02_00323271 predicted 1005
10 SASI_Hs02_00323272 predicted 1124
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052870 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157232 predicted 1227
2 SASI_Hs01_00157233 predicted 1548
3 SASI_Hs02_00361568 predicted 1249
4 SASI_Hs02_00361569 predicted 634
5 SASI_Hs02_00361570 predicted 1533
6 SASI_Hs02_00361571 predicted 1108
7 SASI_Hs01_00157237 predicted 1533
8 SASI_Hs01_00157240 predicted 1046
9 SASI_Hs02_00361572 predicted 1005
10 SASI_Hs02_00361573 predicted 1122
11 SASI_Hs01_00157231 predicted 1643
12 SASI_Hs01_00157234 predicted 1203
13 SASI_Hs01_00157235 predicted 1501
14 SASI_Hs01_00157236 predicted 1275
15 SASI_Hs01_00157238 predicted 1491
16 SASI_Hs01_00157239 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107652 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230935 predicted 2088
2 SASI_Rn02_00230936 predicted 1829
3 SASI_Rn02_00230937 predicted 315
4 SASI_Rn02_00230938 predicted 1980
5 SASI_Rn02_00230939 predicted 1735
6 SASI_Rn02_00230940 predicted 1759
7 SASI_Rn02_00230941 predicted 1003
8 SASI_Rn02_00230942 predicted 989
9 SASI_Rn02_00230943 predicted 1631
10 SASI_Rn02_00230944 predicted 1508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130796 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00143604 predicted 1831
2 SASI_Mm01_00143605 predicted 1174
3 SASI_Mm01_00143608 predicted 1566
4 SASI_Mm01_00143609 predicted 1074
5 SASI_Mm01_00143610 predicted 1895
6 SASI_Mm01_00143611 predicted 1355
7 SASI_Mm01_00143612 predicted 1752
8 SASI_Mm01_00143613 predicted 1737
9 SASI_Mm02_00338268 predicted 2053
10 SASI_Mm02_00338269 predicted 1510
11 SASI_Mm01_00143606 predicted 1918
12 SASI_Mm01_00143607 predicted 1417
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130796
VALIDATED
SNX18 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 18
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130796.1-2990s1c1
Sequence:CCGGCCACTGTGATTCACTCGTTTACTCGAGTAAACGAGTGAATCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130796.1-1865s1c1
Sequence:CCGGGCCGAGATTCATCACTTCCATCTCGAGATGGAAGTGATGAATCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130796.1-1407s1c1
Sequence:CCGGGCAAGATAGATGGCTTCAAATCTCGAGATTTGAAGCCATCTATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130796.1-1868s1c1
Sequence:CCGGGAGATTCATCACTTCCATCAACTCGAGTTGATGGAAGTGATGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130796.1-1834s1c1
Sequence:CCGGCCGCTGTAACACTATTTCCTTCTCGAGAAGGAAATAGTGTTACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130796.3-1877s21c1
Sequence:CCGGGCCGAGATTCATCACTTCCATCTCGAGATGGAAGTGATGAATCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130796.3-1846s21c1
Sequence:CCGGCCGCTGTAACACTATTTCCTTCTCGAGAAGGAAATAGTGTTACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130796.3-1419s21c1
Sequence:CCGGGCAAGATAGATGGCTTCAAATCTCGAGATTTGAAGCCATCTATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302779    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130796.3-3002s21c1
Sequence:CCGGCCACTGTGATTCACTCGTTTACTCGAGTAAACGAGTGAATCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130796.4-1256s21c1
Sequence:GTACCGGTGCGACGTCTTCCAGCATTTCCTCGAGGAAATGCTGGAAGACGTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130796.4-1918s21c1
Sequence:GTACCGGTAAATCACAGATGCAACATTTCTCGAGAAATGTTGCATCTGTGATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130796.4-1999s21c1
Sequence:GTACCGGCAAATACGACAGCGTCTAATGCTCGAGCATTAGACGCTGTCGTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130796
VALIDATED
SNX18 MISSION shRNA shRNA Plasmid DNA
sorting nexin 18
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130796.1-2990s1c1
Sequence:CCGGCCACTGTGATTCACTCGTTTACTCGAGTAAACGAGTGAATCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130796.1-1865s1c1
Sequence:CCGGGCCGAGATTCATCACTTCCATCTCGAGATGGAAGTGATGAATCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130796.1-1407s1c1
Sequence:CCGGGCAAGATAGATGGCTTCAAATCTCGAGATTTGAAGCCATCTATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130796.1-1868s1c1
Sequence:CCGGGAGATTCATCACTTCCATCAACTCGAGTTGATGGAAGTGATGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130796.1-1834s1c1
Sequence:CCGGCCGCTGTAACACTATTTCCTTCTCGAGAAGGAAATAGTGTTACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130796.3-1877s21c1
Sequence:CCGGGCCGAGATTCATCACTTCCATCTCGAGATGGAAGTGATGAATCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130796.3-1846s21c1
Sequence:CCGGCCGCTGTAACACTATTTCCTTCTCGAGAAGGAAATAGTGTTACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130796.3-1419s21c1
Sequence:CCGGGCAAGATAGATGGCTTCAAATCTCGAGATTTGAAGCCATCTATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302779    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130796.3-3002s21c1
Sequence:CCGGCCACTGTGATTCACTCGTTTACTCGAGTAAACGAGTGAATCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130796.4-1256s21c1
Sequence:GTACCGGTGCGACGTCTTCCAGCATTTCCTCGAGGAAATGCTGGAAGACGTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130796.4-1918s21c1
Sequence:GTACCGGTAAATCACAGATGCAACATTTCTCGAGAAATGTTGCATCTGTGATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130796.4-1999s21c1
Sequence:GTACCGGCAAATACGACAGCGTCTAATGCTCGAGCATTAGACGCTGTCGTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130796
VALIDATED
SNX18 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 18
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130796.1-2990s1c1
Sequence:CCGGCCACTGTGATTCACTCGTTTACTCGAGTAAACGAGTGAATCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130796.1-1865s1c1
Sequence:CCGGGCCGAGATTCATCACTTCCATCTCGAGATGGAAGTGATGAATCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130796.1-1407s1c1
Sequence:CCGGGCAAGATAGATGGCTTCAAATCTCGAGATTTGAAGCCATCTATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130796.1-1868s1c1
Sequence:CCGGGAGATTCATCACTTCCATCAACTCGAGTTGATGGAAGTGATGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130796.1-1834s1c1
Sequence:CCGGCCGCTGTAACACTATTTCCTTCTCGAGAAGGAAATAGTGTTACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130796.3-1877s21c1
Sequence:CCGGGCCGAGATTCATCACTTCCATCTCGAGATGGAAGTGATGAATCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130796.3-1846s21c1
Sequence:CCGGCCGCTGTAACACTATTTCCTTCTCGAGAAGGAAATAGTGTTACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130796.3-1419s21c1
Sequence:CCGGGCAAGATAGATGGCTTCAAATCTCGAGATTTGAAGCCATCTATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302779    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130796.3-3002s21c1
Sequence:CCGGCCACTGTGATTCACTCGTTTACTCGAGTAAACGAGTGAATCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130796.4-1256s21c1
Sequence:GTACCGGTGCGACGTCTTCCAGCATTTCCTCGAGGAAATGCTGGAAGACGTCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_130796.4-1918s21c1
Sequence:GTACCGGTAAATCACAGATGCAACATTTCTCGAGAAATGTTGCATCTGTGATTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130796.4-1999s21c1
Sequence:GTACCGGCAAATACGACAGCGTCTAATGCTCGAGCATTAGACGCTGTCGTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052870
VALIDATED
SNX18 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 18
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052870.1-1214s1c1
Sequence:CCGGCCAACTTCTTCCTGACCCTTACTCGAGTAAGGGTCAGGAAGAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052870.1-1697s1c1
Sequence:CCGGCACTGTGGGTTTCAGACTCATCTCGAGATGAGTCTGAAACCCACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052870.1-1068s1c1
Sequence:CCGGGATCTGGTGGATGAACCACATCTCGAGATGTGGTTCATCCACCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_052870.1-1653s1c1
Sequence:CCGGGAGTGTATTGTGCAGGCTGAACTCGAGTTCAGCCTGCACAATACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052870.1-1699s1c1
Sequence:CCGGCTGTGGGTTTCAGACTCATATCTCGAGATATGAGTCTGAAACCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052870.1-1639s1c1
Sequence:CCGGGAGCAGGTGATATGGAGTGTACTCGAGTACACTCCATATCACCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_052870.1-1041s1c1
Sequence:CCGGCTTCATCTCTAAGCGCAGGAACTCGAGTTCCTGCGCTTAGAGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052870.2-1680s21c1
Sequence:CCGGGAGATGCCTATGACGCCATTGCTCGAGCAATGGCGTCATAGGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052870.2-2290s21c1
Sequence:CCGGGTAGAGGAATTAAGATCAATTCTCGAGAATTGATCTTAATTCCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052870.2-2012s21c1
Sequence:CCGGTTAGGGAATGAGTACTCTTTCCTCGAGGAAAGAGTACTCATTCCCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052870.2-2419s21c1
Sequence:CCGGTGAAATTGAGAACGTTGTTTACTCGAGTAAACAACGTTCTCAATTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052870.2-1891s21c1
Sequence:CCGGGTGGGTTTCAGAATCATATTCCTCGAGGAATATGATTCTGAAACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052870.2-2354s21c1
Sequence:CCGGCTTTACGAAGTGAAGTAATTTCTCGAGAAATTACTTCACTTCGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052870.2-1797s21c1
Sequence:CCGGTCCACGTTCAGAAAGGTAAAGCTCGAGCTTTACCTTTCTGAACGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052870
VALIDATED
SNX18 MISSION shRNA shRNA Plasmid DNA
sorting nexin 18
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052870.1-1214s1c1
Sequence:CCGGCCAACTTCTTCCTGACCCTTACTCGAGTAAGGGTCAGGAAGAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052870.1-1697s1c1
Sequence:CCGGCACTGTGGGTTTCAGACTCATCTCGAGATGAGTCTGAAACCCACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052870.1-1068s1c1
Sequence:CCGGGATCTGGTGGATGAACCACATCTCGAGATGTGGTTCATCCACCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_052870.1-1653s1c1
Sequence:CCGGGAGTGTATTGTGCAGGCTGAACTCGAGTTCAGCCTGCACAATACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052870.1-1699s1c1
Sequence:CCGGCTGTGGGTTTCAGACTCATATCTCGAGATATGAGTCTGAAACCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052870.1-1639s1c1
Sequence:CCGGGAGCAGGTGATATGGAGTGTACTCGAGTACACTCCATATCACCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_052870.1-1041s1c1
Sequence:CCGGCTTCATCTCTAAGCGCAGGAACTCGAGTTCCTGCGCTTAGAGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052870.2-1680s21c1
Sequence:CCGGGAGATGCCTATGACGCCATTGCTCGAGCAATGGCGTCATAGGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052870.2-2290s21c1
Sequence:CCGGGTAGAGGAATTAAGATCAATTCTCGAGAATTGATCTTAATTCCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052870.2-2012s21c1
Sequence:CCGGTTAGGGAATGAGTACTCTTTCCTCGAGGAAAGAGTACTCATTCCCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052870.2-2419s21c1
Sequence:CCGGTGAAATTGAGAACGTTGTTTACTCGAGTAAACAACGTTCTCAATTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052870.2-1891s21c1
Sequence:CCGGGTGGGTTTCAGAATCATATTCCTCGAGGAATATGATTCTGAAACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052870.2-2354s21c1
Sequence:CCGGCTTTACGAAGTGAAGTAATTTCTCGAGAAATTACTTCACTTCGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052870.2-1797s21c1
Sequence:CCGGTCCACGTTCAGAAAGGTAAAGCTCGAGCTTTACCTTTCTGAACGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052870
VALIDATED
SNX18 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 18
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052870.1-1214s1c1
Sequence:CCGGCCAACTTCTTCCTGACCCTTACTCGAGTAAGGGTCAGGAAGAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052870.1-1697s1c1
Sequence:CCGGCACTGTGGGTTTCAGACTCATCTCGAGATGAGTCTGAAACCCACAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052870.1-1068s1c1
Sequence:CCGGGATCTGGTGGATGAACCACATCTCGAGATGTGGTTCATCCACCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_052870.1-1653s1c1
Sequence:CCGGGAGTGTATTGTGCAGGCTGAACTCGAGTTCAGCCTGCACAATACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052870.1-1699s1c1
Sequence:CCGGCTGTGGGTTTCAGACTCATATCTCGAGATATGAGTCTGAAACCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052870.1-1639s1c1
Sequence:CCGGGAGCAGGTGATATGGAGTGTACTCGAGTACACTCCATATCACCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_052870.1-1041s1c1
Sequence:CCGGCTTCATCTCTAAGCGCAGGAACTCGAGTTCCTGCGCTTAGAGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052870.2-1680s21c1
Sequence:CCGGGAGATGCCTATGACGCCATTGCTCGAGCAATGGCGTCATAGGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052870.2-2290s21c1
Sequence:CCGGGTAGAGGAATTAAGATCAATTCTCGAGAATTGATCTTAATTCCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052870.2-2012s21c1
Sequence:CCGGTTAGGGAATGAGTACTCTTTCCTCGAGGAAAGAGTACTCATTCCCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418385    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052870.2-2419s21c1
Sequence:CCGGTGAAATTGAGAACGTTGTTTACTCGAGTAAACAACGTTCTCAATTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052870.2-1891s21c1
Sequence:CCGGGTGGGTTTCAGAATCATATTCCTCGAGGAATATGATTCTGAAACCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052870.2-2354s21c1
Sequence:CCGGCTTTACGAAGTGAAGTAATTTCTCGAGAAATTACTTCACTTCGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052870.2-1797s21c1
Sequence:CCGGTCCACGTTCAGAAAGGTAAAGCTCGAGCTTTACCTTTCTGAACGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks