EMAIL THIS PAGE TO A FRIEND

SNX19

sorting nexin 19

Synonyms: CHET8
UniProtKB ID: Q92543
Gene ID:
Mouse(102607) sorting nexin 19
Rat(315478) sorting nexin 19
Zebrafish(568980) sorting nexin 19
domestic cat(101094128) sorting nexin 19
Horse(100072714) sorting nexin 19
dog(479391) sorting nexin 19
chicken(419734) sorting nexin 19
naked mole-rat(101700976) sorting nexin 19
cow(504649) sorting nexin 19
sheep(101120532) sorting nexin 19
102 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028874 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028874 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028874 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014758 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014758 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014758 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014758 Rosetta Predictions human pricing
NM_001108131 Rosetta Predictions rat pricing
NM_028874 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014758 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125141 predicted 597
2 SASI_Hs01_00125142 predicted 2147
3 SASI_Hs01_00125143 predicted 555
4 SASI_Hs01_00125144 predicted 942
5 SASI_Hs01_00125145 predicted 3516
6 SASI_Hs01_00125146 predicted 2155
7 SASI_Hs01_00125147 predicted 865
8 SASI_Hs01_00125148 predicted 3346
9 SASI_Hs02_00346232 predicted 3561
10 SASI_Hs01_00125149 predicted 1167
11 SASI_Hs01_00125150 predicted 3402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108131 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235664 predicted 2839
2 SASI_Rn02_00235665 predicted 747
3 SASI_Rn02_00235666 predicted 1873
4 SASI_Rn02_00235667 predicted 2241
5 SASI_Rn02_00235668 predicted 486
6 SASI_Rn02_00235669 predicted 2376
7 SASI_Rn02_00235670 predicted 638
8 SASI_Rn02_00235671 predicted 2490
9 SASI_Rn02_00235672 predicted 2363
10 SASI_Rn02_00235673 predicted 2582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028874 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334550 predicted 1910
2 SASI_Mm01_00178419 predicted 2751
3 SASI_Mm01_00178420 predicted 2110
4 SASI_Mm01_00178421 predicted 1054
5 SASI_Mm01_00178422 predicted 2256
6 SASI_Mm01_00178424 predicted 630
7 SASI_Mm01_00178425 predicted 1018
8 SASI_Mm01_00178426 predicted 863
9 SASI_Mm01_00178427 predicted 2951
10 SASI_Mm01_00178428 predicted 265
11 SASI_Mm01_00178423 predicted 888
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028874
VALIDATED
SNX19 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 19
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028874.2-3384s21c1
Sequence:CCGGACGGAGCTACATAGCCTATTTCTCGAGAAATAGGCTATGTAGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028874.2-949s21c1
Sequence:CCGGACGTTGTGGTTGAAGTTATTACTCGAGTAATAACTTCAACCACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028874.2-469s21c1
Sequence:CCGGTGCACCTGGAACGATTCATTACTCGAGTAATGAATCGTTCCAGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217331    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028874.2-4002s1c1
Sequence:CCGGGCATGGCAAGTTACGTATTTGCTCGAGCAAATACGTAACTTGCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028874.2-565s21c1
Sequence:CCGGTTATCCGAGACTTCGTGTTATCTCGAGATAACACGAAGTCTCGGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028874.2-1566s21c1
Sequence:CCGGATGCTGGTCTCCGTGCTTAATCTCGAGATTAAGCACGGAGACCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028874.1-3090s1c1
Sequence:CCGGCTCATCAACAGACATTTGATTCTCGAGAATCAAATGTCTGTTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028874.1-2226s1c1
Sequence:CCGGCTGAACACAGATGCTCGGATTCTCGAGAATCCGAGCATCTGTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028874.1-557s1c1
Sequence:CCGGCCAGATGATTATCCGAGACTTCTCGAGAAGTCTCGGATAATCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028874
VALIDATED
SNX19 MISSION shRNA shRNA Plasmid DNA
sorting nexin 19
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028874.2-3384s21c1
Sequence:CCGGACGGAGCTACATAGCCTATTTCTCGAGAAATAGGCTATGTAGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028874.2-949s21c1
Sequence:CCGGACGTTGTGGTTGAAGTTATTACTCGAGTAATAACTTCAACCACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028874.2-469s21c1
Sequence:CCGGTGCACCTGGAACGATTCATTACTCGAGTAATGAATCGTTCCAGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217331    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028874.2-4002s1c1
Sequence:CCGGGCATGGCAAGTTACGTATTTGCTCGAGCAAATACGTAACTTGCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028874.2-565s21c1
Sequence:CCGGTTATCCGAGACTTCGTGTTATCTCGAGATAACACGAAGTCTCGGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028874.2-1566s21c1
Sequence:CCGGATGCTGGTCTCCGTGCTTAATCTCGAGATTAAGCACGGAGACCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028874.1-3090s1c1
Sequence:CCGGCTCATCAACAGACATTTGATTCTCGAGAATCAAATGTCTGTTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028874.1-2226s1c1
Sequence:CCGGCTGAACACAGATGCTCGGATTCTCGAGAATCCGAGCATCTGTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028874.1-557s1c1
Sequence:CCGGCCAGATGATTATCCGAGACTTCTCGAGAAGTCTCGGATAATCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028874
VALIDATED
SNX19 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 19
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249920    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028874.2-3384s21c1
Sequence:CCGGACGGAGCTACATAGCCTATTTCTCGAGAAATAGGCTATGTAGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028874.2-949s21c1
Sequence:CCGGACGTTGTGGTTGAAGTTATTACTCGAGTAATAACTTCAACCACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028874.2-469s21c1
Sequence:CCGGTGCACCTGGAACGATTCATTACTCGAGTAATGAATCGTTCCAGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217331    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028874.2-4002s1c1
Sequence:CCGGGCATGGCAAGTTACGTATTTGCTCGAGCAAATACGTAACTTGCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028874.2-565s21c1
Sequence:CCGGTTATCCGAGACTTCGTGTTATCTCGAGATAACACGAAGTCTCGGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_028874.2-1566s21c1
Sequence:CCGGATGCTGGTCTCCGTGCTTAATCTCGAGATTAAGCACGGAGACCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028874.1-3090s1c1
Sequence:CCGGCTCATCAACAGACATTTGATTCTCGAGAATCAAATGTCTGTTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028874.1-2226s1c1
Sequence:CCGGCTGAACACAGATGCTCGGATTCTCGAGAATCCGAGCATCTGTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193900    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028874.1-557s1c1
Sequence:CCGGCCAGATGATTATCCGAGACTTCTCGAGAAGTCTCGGATAATCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014758
VALIDATED
SNX19 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 19
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014758.2-1875s21c1
Sequence:CCGGTCCTGCCCAGAGATCCATATTCTCGAGAATATGGATCTCTGGGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014758.2-3128s21c1
Sequence:CCGGAGAGGTGCAGGTAGCTAATTTCTCGAGAAATTAGCTACCTGCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014758.2-866s21c1
Sequence:CCGGCCAGATGATTATTCGAGATTTCTCGAGAAATCTCGAATAATCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014758.2-4556s21c1
Sequence:CCGGTCCCATTCCTTACGGTTATAACTCGAGTTATAACCGTAAGGAATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014758.2-2147s21c1
Sequence:CCGGTCGTATCACTGGCACCATTACCTCGAGGTAATGGTGCCAGTGATACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_014758.1-1904s1c1
Sequence:CCGGGAGATGTTACCGCCTCTGTTACTCGAGTAACAGAGGCGGTAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129031    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014758.1-5891s1c1
Sequence:CCGGGCTGTGTTCTTTCTGTCAAATCTCGAGATTTGACAGAAAGAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014758.1-572s1c1
Sequence:CCGGGATCGAGCTGTCACCTCAATACTCGAGTATTGAGGTGACAGCTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130251    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_014758.1-4994s1c1
Sequence:CCGGCCCTAAATTGTGTCTGATGTACTCGAGTACATCAGACACAATTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_014758.1-3280s1c1
Sequence:CCGGCTCCCAGATCTCGTAGTAGAACTCGAGTTCTACTACGAGATCTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014758
VALIDATED
SNX19 MISSION shRNA shRNA Plasmid DNA
sorting nexin 19
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014758.2-1875s21c1
Sequence:CCGGTCCTGCCCAGAGATCCATATTCTCGAGAATATGGATCTCTGGGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014758.2-3128s21c1
Sequence:CCGGAGAGGTGCAGGTAGCTAATTTCTCGAGAAATTAGCTACCTGCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014758.2-866s21c1
Sequence:CCGGCCAGATGATTATTCGAGATTTCTCGAGAAATCTCGAATAATCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014758.2-4556s21c1
Sequence:CCGGTCCCATTCCTTACGGTTATAACTCGAGTTATAACCGTAAGGAATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014758.2-2147s21c1
Sequence:CCGGTCGTATCACTGGCACCATTACCTCGAGGTAATGGTGCCAGTGATACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_014758.1-1904s1c1
Sequence:CCGGGAGATGTTACCGCCTCTGTTACTCGAGTAACAGAGGCGGTAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129031    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014758.1-5891s1c1
Sequence:CCGGGCTGTGTTCTTTCTGTCAAATCTCGAGATTTGACAGAAAGAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014758.1-572s1c1
Sequence:CCGGGATCGAGCTGTCACCTCAATACTCGAGTATTGAGGTGACAGCTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130251    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_014758.1-4994s1c1
Sequence:CCGGCCCTAAATTGTGTCTGATGTACTCGAGTACATCAGACACAATTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_014758.1-3280s1c1
Sequence:CCGGCTCCCAGATCTCGTAGTAGAACTCGAGTTCTACTACGAGATCTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014758
VALIDATED
SNX19 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 19
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014758.2-1875s21c1
Sequence:CCGGTCCTGCCCAGAGATCCATATTCTCGAGAATATGGATCTCTGGGCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014758.2-3128s21c1
Sequence:CCGGAGAGGTGCAGGTAGCTAATTTCTCGAGAAATTAGCTACCTGCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014758.2-866s21c1
Sequence:CCGGCCAGATGATTATTCGAGATTTCTCGAGAAATCTCGAATAATCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236698    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014758.2-4556s21c1
Sequence:CCGGTCCCATTCCTTACGGTTATAACTCGAGTTATAACCGTAAGGAATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014758.2-2147s21c1
Sequence:CCGGTCGTATCACTGGCACCATTACCTCGAGGTAATGGTGCCAGTGATACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_014758.1-1904s1c1
Sequence:CCGGGAGATGTTACCGCCTCTGTTACTCGAGTAACAGAGGCGGTAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129031    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014758.1-5891s1c1
Sequence:CCGGGCTGTGTTCTTTCTGTCAAATCTCGAGATTTGACAGAAAGAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014758.1-572s1c1
Sequence:CCGGGATCGAGCTGTCACCTCAATACTCGAGTATTGAGGTGACAGCTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130251    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_014758.1-4994s1c1
Sequence:CCGGCCCTAAATTGTGTCTGATGTACTCGAGTACATCAGACACAATTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_014758.1-3280s1c1
Sequence:CCGGCTCCCAGATCTCGTAGTAGAACTCGAGTTCTACTACGAGATCTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks