EMAIL THIS PAGE TO A FRIEND

SNX1

sorting nexin 1

Synonyms: HsT17379 VPS5
Gene ID:
Human(6642) Summary: This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This endosomal protein regulates the cell-surface expression of epidermal growth factor receptor. This protein also has a role in sorting protease-activated receptor-1 from early endosomes to lysosomes. This protein may form oligomeric complexes with family members. This gene results in three transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(56440) sorting nexin 1
Rat(84471) sorting nexin 1
fruit fly(33560) Sorting nexin 1
dog(478336) sorting nexin 1
Horse(100066873) sorting nexin 1
domestic cat(101088845) sorting nexin 1
Thale Cress(830501) sorting nexin 1
chicken(427480) sorting nexin 1
naked mole-rat(101706895) sorting nexin 1
Domestic Rabbit(100338927) sorting nexin 1
cow(512029) sorting nexin 1
sheep(101110062) sorting nexin 1
121 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW22324A Anti-SNX1 (ab1) antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
GW22324B Anti-SNX1 (ab2) antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2501610 Anti-SNX1 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, mouse, human, canine
ELISA, immunohistochemistry, western blot pricing
SAB1406463 Anti-SNX1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1409699 Anti-SNX1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA047373 Anti-SNX1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1411304 Anti-SNX1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA052761 Anti-SNX1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
WH0006642M1 Monoclonal Anti-SNX1 antibody produced in mouse clone 6H1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1404390 Monoclonal Anti-SNX1 antibody produced in mouse clone 1E3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019727 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019727 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019727 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003099 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003099 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003099 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003099 Rosetta Predictions human pricing
NM_148955 Rosetta Predictions human pricing
NM_152826 Rosetta Predictions human pricing
NM_053411 Rosetta Predictions rat pricing
NM_019727 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003099 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051508 predicted 862
2 SASI_Hs01_00051510 predicted 951
3 SASI_Hs01_00051511 predicted 1001
4 SASI_Hs02_00335057 predicted 1820
5 SASI_Hs01_00051512 predicted 1749
6 SASI_Hs01_00051513 predicted 1762
7 SASI_Hs02_00335058 predicted 1744
8 SASI_Hs01_00051514 predicted 2044
9 SASI_Hs01_00051516 predicted 1024
10 SASI_Hs01_00051517 predicted 1997
11 SASI_Hs01_00051509 predicted 1862
12 SASI_Hs01_00051515 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130811 predicted 665
2 SASI_Hs01_00130813 predicted 754
3 SASI_Hs01_00130814 predicted 804
4 SASI_Hs02_00365665 predicted 1632
5 SASI_Hs01_00130815 predicted 1555
6 SASI_Hs01_00130816 predicted 1567
7 SASI_Hs02_00365666 predicted 1547
8 SASI_Hs01_00130817 predicted 1851
9 SASI_Hs01_00130819 predicted 826
10 SASI_Hs01_00130820 predicted 1804
11 SASI_Hs01_00130812 predicted 1670
12 SASI_Hs01_00130818 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152826 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145663 predicted 864
2 SASI_Hs01_00145665 predicted 943
3 SASI_Hs01_00145666 predicted 1000
4 SASI_Hs02_00366743 predicted 1683
5 SASI_Hs01_00145667 predicted 1610
6 SASI_Hs01_00145668 predicted 1623
7 SASI_Hs02_00366744 predicted 1601
8 SASI_Hs01_00145669 predicted 1906
9 SASI_Hs01_00145671 predicted 1024
10 SASI_Hs01_00145672 predicted 1850
11 SASI_Hs01_00145664 predicted 1714
12 SASI_Hs01_00145670 predicted 906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053411 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032315 predicted 822
2 SASI_Rn01_00032316 predicted 1254
3 SASI_Rn01_00032317 predicted 926
4 SASI_Rn02_00265932 predicted 1078
5 SASI_Rn02_00265933 predicted 1519
6 SASI_Rn01_00032318 predicted 1398
7 SASI_Rn01_00032319 predicted 745
8 SASI_Rn01_00032320 predicted 940
9 SASI_Rn02_00265934 predicted 433
10 SASI_Rn02_00265935 predicted 709
11 SASI_Rn01_00032314 predicted 997
12 SASI_Rn01_00032321 predicted 1480
13 SASI_Rn01_00032322 predicted 835
14 SASI_Rn01_00032323 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019727 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079524 predicted 1508
2 SASI_Mm01_00079525 predicted 964
3 SASI_Mm01_00079526 predicted 752
4 SASI_Mm01_00079527 predicted 1286
5 SASI_Mm01_00079528 predicted 1024
6 SASI_Mm01_00079529 predicted 758
7 SASI_Mm01_00079530 predicted 791
8 SASI_Mm01_00079531 predicted 1046
9 SASI_Mm01_00079532 predicted 988
10 SASI_Mm01_00079533 predicted 1427
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019727
VALIDATED
SNX1 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019727.2-679s21c1
Sequence:CCGGCAGTGACTTCCTGGGTCTTTACTCGAGTAAAGACCCAGGAAGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019727.2-1824s21c1
Sequence:CCGGCCAGTTACTCTAACCAACATTCTCGAGAATGTTGGTTAGAGTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019727.2-750s21c1
Sequence:CCGGCACCCGAGAAGAGCCTAATAGCTCGAGCTATTAGGCTCTTCTCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019727.2-597s21c1
Sequence:CCGGATGCCTATGTAGCCTACAAAGCTCGAGCTTTGTAGGCTACATAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019727.2-1295s21c1
Sequence:CCGGGCTGAACTCCTGAGTGACTATCTCGAGATAGTCACTCAGGAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019727.2-718s21c1
Sequence:CCGGGCACTCCCAGAATGGTTTCATCTCGAGATGAAACCATTCTGGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093184    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019727.2-1824s1c1
Sequence:CCGGCCAGTTACTCTAACCAACATTCTCGAGAATGTTGGTTAGAGTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019727.2-1295s1c1
Sequence:CCGGGCTGAACTCCTGAGTGACTATCTCGAGATAGTCACTCAGGAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019727.2-718s1c1
Sequence:CCGGGCACTCCCAGAATGGTTTCATCTCGAGATGAAACCATTCTGGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019727.2-412s1c1
Sequence:CCGGCCTGGACAGCACACAGAATAACTCGAGTTATTCTGTGTGCTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019727.2-1541s1c1
Sequence:CCGGCGAAAGGAAGTGACACGATTTCTCGAGAAATCGTGTCACTTCCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019727
VALIDATED
SNX1 MISSION shRNA shRNA Plasmid DNA
sorting nexin 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019727.2-679s21c1
Sequence:CCGGCAGTGACTTCCTGGGTCTTTACTCGAGTAAAGACCCAGGAAGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019727.2-1824s21c1
Sequence:CCGGCCAGTTACTCTAACCAACATTCTCGAGAATGTTGGTTAGAGTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019727.2-750s21c1
Sequence:CCGGCACCCGAGAAGAGCCTAATAGCTCGAGCTATTAGGCTCTTCTCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019727.2-597s21c1
Sequence:CCGGATGCCTATGTAGCCTACAAAGCTCGAGCTTTGTAGGCTACATAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019727.2-1295s21c1
Sequence:CCGGGCTGAACTCCTGAGTGACTATCTCGAGATAGTCACTCAGGAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019727.2-718s21c1
Sequence:CCGGGCACTCCCAGAATGGTTTCATCTCGAGATGAAACCATTCTGGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093184    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019727.2-1824s1c1
Sequence:CCGGCCAGTTACTCTAACCAACATTCTCGAGAATGTTGGTTAGAGTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019727.2-1295s1c1
Sequence:CCGGGCTGAACTCCTGAGTGACTATCTCGAGATAGTCACTCAGGAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019727.2-718s1c1
Sequence:CCGGGCACTCCCAGAATGGTTTCATCTCGAGATGAAACCATTCTGGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019727.2-412s1c1
Sequence:CCGGCCTGGACAGCACACAGAATAACTCGAGTTATTCTGTGTGCTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019727.2-1541s1c1
Sequence:CCGGCGAAAGGAAGTGACACGATTTCTCGAGAAATCGTGTCACTTCCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019727
VALIDATED
SNX1 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019727.2-679s21c1
Sequence:CCGGCAGTGACTTCCTGGGTCTTTACTCGAGTAAAGACCCAGGAAGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019727.2-1824s21c1
Sequence:CCGGCCAGTTACTCTAACCAACATTCTCGAGAATGTTGGTTAGAGTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019727.2-750s21c1
Sequence:CCGGCACCCGAGAAGAGCCTAATAGCTCGAGCTATTAGGCTCTTCTCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019727.2-597s21c1
Sequence:CCGGATGCCTATGTAGCCTACAAAGCTCGAGCTTTGTAGGCTACATAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019727.2-1295s21c1
Sequence:CCGGGCTGAACTCCTGAGTGACTATCTCGAGATAGTCACTCAGGAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019727.2-718s21c1
Sequence:CCGGGCACTCCCAGAATGGTTTCATCTCGAGATGAAACCATTCTGGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093184    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019727.2-1824s1c1
Sequence:CCGGCCAGTTACTCTAACCAACATTCTCGAGAATGTTGGTTAGAGTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019727.2-1295s1c1
Sequence:CCGGGCTGAACTCCTGAGTGACTATCTCGAGATAGTCACTCAGGAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019727.2-718s1c1
Sequence:CCGGGCACTCCCAGAATGGTTTCATCTCGAGATGAAACCATTCTGGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019727.2-412s1c1
Sequence:CCGGCCTGGACAGCACACAGAATAACTCGAGTTATTCTGTGTGCTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019727.2-1541s1c1
Sequence:CCGGCGAAAGGAAGTGACACGATTTCTCGAGAAATCGTGTCACTTCCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003099
VALIDATED
SNX1 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003099.3-3960s21c1
Sequence:CCGGGCGTCGTAATCAGCATATAATCTCGAGATTATATGCTGATTACGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003099.3-1406s21c1
Sequence:CCGGAGTCTCGGGTGACTCAATATGCTCGAGCATATTGAGTCACCCGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003099.3-768s21c1
Sequence:CCGGGTACCTTCAGAGGATTGTAAACTCGAGTTTACAATCCTCTGAAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003099.3-597s21c1
Sequence:CCGGTAGTGACTTTCTGGGTCTTTACTCGAGTAAAGACCCAGAAAGTCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003099.3-465s21c1
Sequence:CCGGTGATTTGACAGTCGGTATAACCTCGAGGTTATACCGACTGTCAAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003975    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_003099.x-1812s1c1
Sequence:CCGGTAGGTGGTGGAATTATGGGATCTCGAGATCCCATAATTCCACCACCTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003099.x-1441s1c1
Sequence:CCGGGAAGTGATACGGTTTGAGAAACTCGAGTTTCTCAAACCGTATCACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003099.x-1413s1c1
Sequence:CCGGCGAGAGGATTTCAACAGTGGTCTCGAGACCACTGTTGAAATCCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_003099.x-453s1c1
Sequence:CCGGCGGTATAACTGATCCTGAGAACTCGAGTTCTCAGGATCAGTTATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003099.x-171s1c1
Sequence:CCGGCAGTAAACATCAGTCTCCAAACTCGAGTTTGGAGACTGATGTTTACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003099
VALIDATED
SNX1 MISSION shRNA shRNA Plasmid DNA
sorting nexin 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003099.3-3960s21c1
Sequence:CCGGGCGTCGTAATCAGCATATAATCTCGAGATTATATGCTGATTACGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003099.3-1406s21c1
Sequence:CCGGAGTCTCGGGTGACTCAATATGCTCGAGCATATTGAGTCACCCGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003099.3-768s21c1
Sequence:CCGGGTACCTTCAGAGGATTGTAAACTCGAGTTTACAATCCTCTGAAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003099.3-597s21c1
Sequence:CCGGTAGTGACTTTCTGGGTCTTTACTCGAGTAAAGACCCAGAAAGTCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003099.3-465s21c1
Sequence:CCGGTGATTTGACAGTCGGTATAACCTCGAGGTTATACCGACTGTCAAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003975    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_003099.x-1812s1c1
Sequence:CCGGTAGGTGGTGGAATTATGGGATCTCGAGATCCCATAATTCCACCACCTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003099.x-1441s1c1
Sequence:CCGGGAAGTGATACGGTTTGAGAAACTCGAGTTTCTCAAACCGTATCACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003099.x-1413s1c1
Sequence:CCGGCGAGAGGATTTCAACAGTGGTCTCGAGACCACTGTTGAAATCCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_003099.x-453s1c1
Sequence:CCGGCGGTATAACTGATCCTGAGAACTCGAGTTCTCAGGATCAGTTATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003099.x-171s1c1
Sequence:CCGGCAGTAAACATCAGTCTCCAAACTCGAGTTTGGAGACTGATGTTTACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003099
VALIDATED
SNX1 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003099.3-3960s21c1
Sequence:CCGGGCGTCGTAATCAGCATATAATCTCGAGATTATATGCTGATTACGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003099.3-1406s21c1
Sequence:CCGGAGTCTCGGGTGACTCAATATGCTCGAGCATATTGAGTCACCCGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_003099.3-768s21c1
Sequence:CCGGGTACCTTCAGAGGATTGTAAACTCGAGTTTACAATCCTCTGAAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003099.3-597s21c1
Sequence:CCGGTAGTGACTTTCTGGGTCTTTACTCGAGTAAAGACCCAGAAAGTCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003099.3-465s21c1
Sequence:CCGGTGATTTGACAGTCGGTATAACCTCGAGGTTATACCGACTGTCAAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003975    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_003099.x-1812s1c1
Sequence:CCGGTAGGTGGTGGAATTATGGGATCTCGAGATCCCATAATTCCACCACCTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003099.x-1441s1c1
Sequence:CCGGGAAGTGATACGGTTTGAGAAACTCGAGTTTCTCAAACCGTATCACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003099.x-1413s1c1
Sequence:CCGGCGAGAGGATTTCAACAGTGGTCTCGAGACCACTGTTGAAATCCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_003099.x-453s1c1
Sequence:CCGGCGGTATAACTGATCCTGAGAACTCGAGTTCTCAGGATCAGTTATACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003099.x-171s1c1
Sequence:CCGGCAGTAAACATCAGTCTCCAAACTCGAGTTTGGAGACTGATGTTTACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks