EMAIL THIS PAGE TO A FRIEND

SNX20

sorting nexin 20

Synonyms: SLIC1
UniProtKB ID: Q7Z614, A8K9D5, Q08E98, Q6P4H2, Q8IV59
Gene ID:
Human(124460) Summary: SNX20 interacts with the cytoplasmic domain of PSGL1 (SELPLG; MIM 600738) and cycles PSGL1 into endosomes.[supplied by OMIM, Feb 2010]
Mouse(71607) sorting nexin 20
Rat(307742) sorting nexin 20
naked mole-rat(101709721) sorting nexin 20
cow(505256) sorting nexin 20
sheep(101117100) sorting nexin 20
chicken(415726) sorting nexin 20
domestic cat(101094389) sorting nexin 20
dog(487287) sorting nexin 20
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182854 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182854 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182854 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027840 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027840 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027840 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153337 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153337 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153337 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182854 Rosetta Predictions human pricing
NM_001024999 Rosetta Predictions rat pricing
NM_027840 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182854 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132294 predicted 522
2 SASI_Hs01_00132296 predicted 291
3 SASI_Hs01_00132297 predicted 603
4 SASI_Hs01_00132298 predicted 280
5 SASI_Hs01_00132299 predicted 375
6 SASI_Hs01_00132300 predicted 345
7 SASI_Hs01_00132301 predicted 280
8 SASI_Hs01_00132302 predicted 296
9 SASI_Hs01_00132303 predicted 468
10 SASI_Hs02_00370988 predicted 418
11 SASI_Hs01_00132295 predicted 340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024999 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056039 predicted 1111
2 SASI_Rn01_00056040 predicted 577
3 SASI_Rn01_00056041 predicted 356
4 SASI_Rn01_00056042 predicted 1099
5 SASI_Rn01_00056043 predicted 627
6 SASI_Rn01_00056045 predicted 214
7 SASI_Rn01_00056046 predicted 410
8 SASI_Rn01_00056047 predicted 777
9 SASI_Rn01_00056048 predicted 502
10 SASI_Rn02_00202896 predicted 1082
11 SASI_Rn01_00056044 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027840 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105632 predicted 417
2 SASI_Mm01_00105633 predicted 418
3 SASI_Mm02_00332803 predicted 634
4 SASI_Mm02_00332804 predicted 680
5 SASI_Mm01_00105634 predicted 195
6 SASI_Mm01_00105637 predicted 343
7 SASI_Mm02_00332805 predicted 836
8 SASI_Mm02_00332806 predicted 930
9 SASI_Mm01_00105639 predicted 472
10 SASI_Mm01_00105641 predicted 1066
11 SASI_Mm01_00105635 predicted 417
12 SASI_Mm01_00105636 predicted 1125
13 SASI_Mm01_00105638 predicted 401
14 SASI_Mm01_00105640 predicted 512
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182854
SNX20 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 20
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182854.2-1094s21c1
Sequence:CCGGGGAGCTCACTGTGCGAGAATACTCGAGTATTCTCGCACAGTGAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182854.2-574s21c1
Sequence:CCGGAGATCGAAGACGTGGAGTTTCCTCGAGGAAACTCCACGTCTTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182854.1-1164s21c1
Sequence:CCGGAGTGCAGTGGCTCAATTATGTCTCGAGACATAATTGAGCCACTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182854.1-290s21c1
Sequence:CCGGAGCACGTCAAACTGCTCTTTGCTCGAGCAAAGAGCAGTTTGACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182854.2-1263s21c1
Sequence:CCGGGTGCAGTGGCTCAATTATGTCCTCGAGGACATAATTGAGCCACTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182854.2-529s21c1
Sequence:CCGGACTTCGCGAAGCTCCAGAAAGCTCGAGCTTTCTGGAGCTTCGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182854.2-359s21c1
Sequence:CCGGGTACTGGCAGAACCAGAAATGCTCGAGCATTTCTGGTTCTGCCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182854.2-455s21c1
Sequence:CCGGGGTGTACCAAATCATCGTCATCTCGAGATGACGATGATTTGGTACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182854
SNX20 MISSION shRNA shRNA Plasmid DNA
sorting nexin 20
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182854.2-1094s21c1
Sequence:CCGGGGAGCTCACTGTGCGAGAATACTCGAGTATTCTCGCACAGTGAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182854.2-574s21c1
Sequence:CCGGAGATCGAAGACGTGGAGTTTCCTCGAGGAAACTCCACGTCTTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182854.1-1164s21c1
Sequence:CCGGAGTGCAGTGGCTCAATTATGTCTCGAGACATAATTGAGCCACTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182854.1-290s21c1
Sequence:CCGGAGCACGTCAAACTGCTCTTTGCTCGAGCAAAGAGCAGTTTGACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182854.2-1263s21c1
Sequence:CCGGGTGCAGTGGCTCAATTATGTCCTCGAGGACATAATTGAGCCACTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182854.2-529s21c1
Sequence:CCGGACTTCGCGAAGCTCCAGAAAGCTCGAGCTTTCTGGAGCTTCGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182854.2-359s21c1
Sequence:CCGGGTACTGGCAGAACCAGAAATGCTCGAGCATTTCTGGTTCTGCCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182854.2-455s21c1
Sequence:CCGGGGTGTACCAAATCATCGTCATCTCGAGATGACGATGATTTGGTACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182854
SNX20 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 20
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182854.2-1094s21c1
Sequence:CCGGGGAGCTCACTGTGCGAGAATACTCGAGTATTCTCGCACAGTGAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182854.2-574s21c1
Sequence:CCGGAGATCGAAGACGTGGAGTTTCCTCGAGGAAACTCCACGTCTTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182854.1-1164s21c1
Sequence:CCGGAGTGCAGTGGCTCAATTATGTCTCGAGACATAATTGAGCCACTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182854.1-290s21c1
Sequence:CCGGAGCACGTCAAACTGCTCTTTGCTCGAGCAAAGAGCAGTTTGACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182854.2-1263s21c1
Sequence:CCGGGTGCAGTGGCTCAATTATGTCCTCGAGGACATAATTGAGCCACTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182854.2-529s21c1
Sequence:CCGGACTTCGCGAAGCTCCAGAAAGCTCGAGCTTTCTGGAGCTTCGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182854.2-359s21c1
Sequence:CCGGGTACTGGCAGAACCAGAAATGCTCGAGCATTTCTGGTTCTGCCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182854.2-455s21c1
Sequence:CCGGGGTGTACCAAATCATCGTCATCTCGAGATGACGATGATTTGGTACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027840
SNX20 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 20
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027840.3-412s21c1
Sequence:CCGGAGAGGAAAGTCTCCAAGTTTGCTCGAGCAAACTTGGAGACTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027840.3-196s21c1
Sequence:CCGGGGAGAGGACCCATAAACCAATCTCGAGATTGGTTTATGGGTCCTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027840.3-1245s21c1
Sequence:CCGGTTGAGTGCCAGGTTCTCTAAACTCGAGTTTAGAGAACCTGGCACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027840.3-273s21c1
Sequence:CCGGGGACCAGAAGAAGCCCAAGATCTCGAGATCTTGGGCTTCTTCTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027840.3-434s21c1
Sequence:CCGGGATGTACCAAGTCGTGGTCATCTCGAGATGACCACGACTTGGTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027840.1-367s1c1
Sequence:CCGGGAAACATGTCAGGCTGCTCTTCTCGAGAAGAGCAGCCTGACATGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027840.1-418s1c1
Sequence:CCGGGAAAGTCTCCAAGTTTGTGATCTCGAGATCACAAACTTGGAGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027840.1-436s1c1
Sequence:CCGGGATGTACCAAGTCGTGGTCATCTCGAGATGACCACGACTTGGTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027840
SNX20 MISSION shRNA shRNA Plasmid DNA
sorting nexin 20
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027840.3-412s21c1
Sequence:CCGGAGAGGAAAGTCTCCAAGTTTGCTCGAGCAAACTTGGAGACTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027840.3-196s21c1
Sequence:CCGGGGAGAGGACCCATAAACCAATCTCGAGATTGGTTTATGGGTCCTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027840.3-1245s21c1
Sequence:CCGGTTGAGTGCCAGGTTCTCTAAACTCGAGTTTAGAGAACCTGGCACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027840.3-273s21c1
Sequence:CCGGGGACCAGAAGAAGCCCAAGATCTCGAGATCTTGGGCTTCTTCTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027840.3-434s21c1
Sequence:CCGGGATGTACCAAGTCGTGGTCATCTCGAGATGACCACGACTTGGTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027840.1-367s1c1
Sequence:CCGGGAAACATGTCAGGCTGCTCTTCTCGAGAAGAGCAGCCTGACATGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027840.1-418s1c1
Sequence:CCGGGAAAGTCTCCAAGTTTGTGATCTCGAGATCACAAACTTGGAGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027840.1-436s1c1
Sequence:CCGGGATGTACCAAGTCGTGGTCATCTCGAGATGACCACGACTTGGTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027840
SNX20 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 20
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027840.3-412s21c1
Sequence:CCGGAGAGGAAAGTCTCCAAGTTTGCTCGAGCAAACTTGGAGACTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027840.3-196s21c1
Sequence:CCGGGGAGAGGACCCATAAACCAATCTCGAGATTGGTTTATGGGTCCTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027840.3-1245s21c1
Sequence:CCGGTTGAGTGCCAGGTTCTCTAAACTCGAGTTTAGAGAACCTGGCACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027840.3-273s21c1
Sequence:CCGGGGACCAGAAGAAGCCCAAGATCTCGAGATCTTGGGCTTCTTCTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027840.3-434s21c1
Sequence:CCGGGATGTACCAAGTCGTGGTCATCTCGAGATGACCACGACTTGGTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027840.1-367s1c1
Sequence:CCGGGAAACATGTCAGGCTGCTCTTCTCGAGAAGAGCAGCCTGACATGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027840.1-418s1c1
Sequence:CCGGGAAAGTCTCCAAGTTTGTGATCTCGAGATCACAAACTTGGAGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027840.1-436s1c1
Sequence:CCGGGATGTACCAAGTCGTGGTCATCTCGAGATGACCACGACTTGGTACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153337
SNX20 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 20
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000180832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153337.1-338s1c1
Sequence:CCGGGCACGTCAAACTGCTCTTTGACTCGAGTCAAAGAGCAGTTTGACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153337
SNX20 MISSION shRNA shRNA Plasmid DNA
sorting nexin 20
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000180832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153337.1-338s1c1
Sequence:CCGGGCACGTCAAACTGCTCTTTGACTCGAGTCAAAGAGCAGTTTGACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153337
SNX20 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 20
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000180832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153337.1-338s1c1
Sequence:CCGGGCACGTCAAACTGCTCTTTGACTCGAGTCAAAGAGCAGTTTGACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks