EMAIL THIS PAGE TO A FRIEND

SNX21

sorting nexin family member 21

Synonyms: C20orf161 PP3993 SNX-L dJ337O18.4
UniProtKB ID: Q969T3, Q5JZH5, Q5JZH6, Q5JZH7, Q8WUR6, Q9BR16
Gene ID:
Human(90203) Summary: This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like some family members. The specific function of this protein has not been determined. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(101113) sorting nexin family member 21
Rat(100362940) sorting nexin family member 21
Zebrafish(555580) sorting nexin family member 21
chicken(419302) sorting nexin family member 21
domestic cat(101086132) sorting nexin family member 21
Horse(100071099) sorting nexin family member 21
dog(485900) sorting nexin family member 21
cow(100125285) sorting nexin family member 21
sheep(101112840) sorting nexin family member 21
domestic guinea pig(100719122) sorting nexin family member 21
naked mole-rat(101723049) sorting nexin family member 21
112 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133924 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133924 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133924 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033421 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033421 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033421 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083531 MISSION® esiRNA esiRNA human SNX21 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042632 Rosetta Predictions human pricing
NM_001042633 Rosetta Predictions human pricing
NM_033421 Rosetta Predictions human pricing
NM_152897 Rosetta Predictions human pricing
NM_133924 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310843 predicted 556
2 SASI_Hs02_00310844 predicted 494
3 SASI_Hs02_00310845 predicted 611
4 SASI_Hs02_00310846 predicted 569
5 SASI_Hs02_00310847 predicted 356
6 SASI_Hs02_00310848 predicted 1035
7 SASI_Hs02_00310849 predicted 1035
8 SASI_Hs02_00310850 predicted 663
9 SASI_Hs02_00310851 predicted 600
10 SASI_Hs02_00310852 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310853 predicted 574
2 SASI_Hs02_00310854 predicted 490
3 SASI_Hs02_00310855 predicted 532
4 SASI_Hs02_00310856 predicted 633
5 SASI_Hs02_00310857 predicted 590
6 SASI_Hs02_00310858 predicted 356
7 SASI_Hs02_00310859 predicted 1048
8 SASI_Hs02_00310860 predicted 518
9 SASI_Hs02_00310861 predicted 1054
10 SASI_Hs02_00310862 predicted 687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033421 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046358 predicted 1200
2 SASI_Hs01_00046359 predicted 1355
3 SASI_Hs01_00046360 predicted 493
4 SASI_Hs01_00046361 predicted 617
5 SASI_Hs01_00046362 predicted 583
6 SASI_Hs01_00046363 predicted 355
7 SASI_Hs01_00046364 predicted 1620
8 SASI_Hs01_00046365 predicted 1042
9 SASI_Hs01_00046366 predicted 672
10 SASI_Hs01_00046367 predicted 602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152897 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199300 predicted 987
2 SASI_Hs01_00199301 predicted 1041
3 SASI_Hs01_00199302 predicted 1036
4 SASI_Hs01_00199303 predicted 1050
5 SASI_Hs01_00199304 predicted 999
6 SASI_Hs01_00199305 predicted 999
7 SASI_Hs01_00199307 predicted 1037
8 SASI_Hs01_00199308 predicted 1042
9 SASI_Hs01_00199309 predicted 1022
10 SASI_Hs02_00366863 predicted 987
11 SASI_Hs01_00199306 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133924 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339009 predicted 441
2 SASI_Mm02_00339010 predicted 1065
3 SASI_Mm02_00339011 predicted 1157
4 SASI_Mm02_00339012 predicted 962
5 SASI_Mm02_00339013 predicted 1112
6 SASI_Mm02_00339014 predicted 1214
7 SASI_Mm01_00077633 predicted 382
8 SASI_Mm02_00339015 predicted 764
9 SASI_Mm02_00339016 predicted 489
10 SASI_Mm02_00339017 predicted 532
11 SASI_Mm01_00077628 predicted 944
12 SASI_Mm01_00077629 predicted 726
13 SASI_Mm01_00077630 predicted 794
14 SASI_Mm01_00077631 predicted 933
15 SASI_Mm01_00077632 predicted 633
16 SASI_Mm01_00077634 predicted 798
17 SASI_Mm01_00077635 predicted 456
18 SASI_Mm01_00077636 predicted 989
19 SASI_Mm01_00077637 predicted 699
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133924
VALIDATED
SNX21 MISSION shRNA Bacterial Glycerol Stock
sorting nexin family member 21
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201114    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133924.1-643s1c1
Sequence:CCGGCTCAGGCAAATGACTTAGTTTCTCGAGAAACTAAGTCATTTGCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133924.1-648s1c1
Sequence:CCGGGCAAATGACTTAGTTTCTCTACTCGAGTAGAGAAACTAAGTCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191517    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133924.1-521s1c1
Sequence:CCGGGAAAGGAAATAGCACAGATTTCTCGAGAAATCTGTGCTATTTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133924.1-432s1c1
Sequence:CCGGGCCAATGTTGTCAAAGACCCTCTCGAGAGGGTCTTTGACAACATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133924.3-581s21c1
Sequence:GTACCGGCCATGTCTGCCATCTCCTTTCCTCGAGGAAAGGAGATGGCAGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133924.3-520s21c1
Sequence:GTACCGGTCTCGCCGATACTCGGACTTTCTCGAGAAAGTCCGAGTATCGGCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133924.3-762s21c1
Sequence:CCGGCCTCACCTGCACTGGTCTTTACTCGAGTAAAGACCAGTGCAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133924.3-1118s21c1
Sequence:CCGGTCAAAGAGGTGCTGGACTAATCTCGAGATTAGTCCAGCACCTCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346861    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133924.3-1221s21c1
Sequence:CCGGCTATTGAGTAGTTCCAGAAAGCTCGAGCTTTCTGGAACTACTCAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133924.3-427s21c1
Sequence:CCGGGCCAATGTTGTCAAAGACCCTCTCGAGAGGGTCTTTGACAACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133924.3-552s21c1
Sequence:CCGGCAGAAACCTGCAGCGGCAATTCTCGAGAATTGCCGCTGCAGGTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133924.3-971s21c1
Sequence:GTACCGGATCCTTTCCTGGCACCCTTTCCTCGAGGAAAGGGTGCCAGGAAAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133924.3-1262s21c1
Sequence:GTACCGGGAACTTTATTATGCCAGACAGCTCGAGCTGTCTGGCATAATAAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133924.3-377s21c1
Sequence:GTACCGGAGTCTCGGAACACCCTAGTTCCTCGAGGAACTAGGGTGTTCCGAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133924
VALIDATED
SNX21 MISSION shRNA shRNA Plasmid DNA
sorting nexin family member 21
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201114    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133924.1-643s1c1
Sequence:CCGGCTCAGGCAAATGACTTAGTTTCTCGAGAAACTAAGTCATTTGCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133924.1-648s1c1
Sequence:CCGGGCAAATGACTTAGTTTCTCTACTCGAGTAGAGAAACTAAGTCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191517    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133924.1-521s1c1
Sequence:CCGGGAAAGGAAATAGCACAGATTTCTCGAGAAATCTGTGCTATTTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133924.1-432s1c1
Sequence:CCGGGCCAATGTTGTCAAAGACCCTCTCGAGAGGGTCTTTGACAACATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133924.3-581s21c1
Sequence:GTACCGGCCATGTCTGCCATCTCCTTTCCTCGAGGAAAGGAGATGGCAGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133924.3-520s21c1
Sequence:GTACCGGTCTCGCCGATACTCGGACTTTCTCGAGAAAGTCCGAGTATCGGCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133924.3-762s21c1
Sequence:CCGGCCTCACCTGCACTGGTCTTTACTCGAGTAAAGACCAGTGCAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133924.3-1118s21c1
Sequence:CCGGTCAAAGAGGTGCTGGACTAATCTCGAGATTAGTCCAGCACCTCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346861    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133924.3-1221s21c1
Sequence:CCGGCTATTGAGTAGTTCCAGAAAGCTCGAGCTTTCTGGAACTACTCAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133924.3-427s21c1
Sequence:CCGGGCCAATGTTGTCAAAGACCCTCTCGAGAGGGTCTTTGACAACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133924.3-552s21c1
Sequence:CCGGCAGAAACCTGCAGCGGCAATTCTCGAGAATTGCCGCTGCAGGTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133924.3-971s21c1
Sequence:GTACCGGATCCTTTCCTGGCACCCTTTCCTCGAGGAAAGGGTGCCAGGAAAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133924.3-1262s21c1
Sequence:GTACCGGGAACTTTATTATGCCAGACAGCTCGAGCTGTCTGGCATAATAAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133924.3-377s21c1
Sequence:GTACCGGAGTCTCGGAACACCCTAGTTCCTCGAGGAACTAGGGTGTTCCGAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133924
VALIDATED
SNX21 MISSION shRNA Lentiviral Transduction Particles
sorting nexin family member 21
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201114    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133924.1-643s1c1
Sequence:CCGGCTCAGGCAAATGACTTAGTTTCTCGAGAAACTAAGTCATTTGCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191830    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133924.1-648s1c1
Sequence:CCGGGCAAATGACTTAGTTTCTCTACTCGAGTAGAGAAACTAAGTCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191517    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133924.1-521s1c1
Sequence:CCGGGAAAGGAAATAGCACAGATTTCTCGAGAAATCTGTGCTATTTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133924.1-432s1c1
Sequence:CCGGGCCAATGTTGTCAAAGACCCTCTCGAGAGGGTCTTTGACAACATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133924.3-581s21c1
Sequence:GTACCGGCCATGTCTGCCATCTCCTTTCCTCGAGGAAAGGAGATGGCAGACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133924.3-520s21c1
Sequence:GTACCGGTCTCGCCGATACTCGGACTTTCTCGAGAAAGTCCGAGTATCGGCGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133924.3-762s21c1
Sequence:CCGGCCTCACCTGCACTGGTCTTTACTCGAGTAAAGACCAGTGCAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133924.3-1118s21c1
Sequence:CCGGTCAAAGAGGTGCTGGACTAATCTCGAGATTAGTCCAGCACCTCTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346861    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133924.3-1221s21c1
Sequence:CCGGCTATTGAGTAGTTCCAGAAAGCTCGAGCTTTCTGGAACTACTCAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133924.3-427s21c1
Sequence:CCGGGCCAATGTTGTCAAAGACCCTCTCGAGAGGGTCTTTGACAACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133924.3-552s21c1
Sequence:CCGGCAGAAACCTGCAGCGGCAATTCTCGAGAATTGCCGCTGCAGGTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133924.3-971s21c1
Sequence:GTACCGGATCCTTTCCTGGCACCCTTTCCTCGAGGAAAGGGTGCCAGGAAAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381194    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133924.3-1262s21c1
Sequence:GTACCGGGAACTTTATTATGCCAGACAGCTCGAGCTGTCTGGCATAATAAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133924.3-377s21c1
Sequence:GTACCGGAGTCTCGGAACACCCTAGTTCCTCGAGGAACTAGGGTGTTCCGAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033421
SNX21 MISSION shRNA Bacterial Glycerol Stock
sorting nexin family member 21
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033421.2-2676s1c1
Sequence:CCGGCCTCACTTCAAGGTTATCAATCTCGAGATTGATAACCTTGAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033421.2-521s1c1
Sequence:CCGGGCCCTCCAAGTACGTGCTCTACTCGAGTAGAGCACGTACTTGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033421.2-836s1c1
Sequence:CCGGCCTCACCTGTACTGGCCTCTACTCGAGTAGAGGCCAGTACAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033421.2-431s1c1
Sequence:CCGGGCTGCAGGATTTCTGGAAGAACTCGAGTTCTTCCAGAAATCCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033421.2-1171s1c1
Sequence:CCGGCCAGTCTCAAAGAATTGCTCACTCGAGTGAGCAATTCTTTGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033421.2-699s21c1
Sequence:GTACCGGTTTACTGCAGAGACCATTGCCCTCGAGGGCAATGGTCTCTGCAGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033421.2-1098s21c1
Sequence:GTACCGGGGCCTGGACAAACGTCAATCACTCGAGTGATTGACGTTTGTCCAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033421.2-360s21c1
Sequence:GTACCGGACGTCAGGAGAAGACGCAGAACTCGAGTTCTGCGTCTTCTCCTGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033421.2-186s21c1
Sequence:GTACCGGAGTCCAGAGGCCGAGCAGTTTCTCGAGAAACTGCTCGGCCTCTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033421.2-1032s21c1
Sequence:GTACCGGGACAAGAGCCTCCACCCTTTGCTCGAGCAAAGGGTGGAGGCTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033421
SNX21 MISSION shRNA shRNA Plasmid DNA
sorting nexin family member 21
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033421.2-2676s1c1
Sequence:CCGGCCTCACTTCAAGGTTATCAATCTCGAGATTGATAACCTTGAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033421.2-521s1c1
Sequence:CCGGGCCCTCCAAGTACGTGCTCTACTCGAGTAGAGCACGTACTTGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033421.2-836s1c1
Sequence:CCGGCCTCACCTGTACTGGCCTCTACTCGAGTAGAGGCCAGTACAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033421.2-431s1c1
Sequence:CCGGGCTGCAGGATTTCTGGAAGAACTCGAGTTCTTCCAGAAATCCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033421.2-1171s1c1
Sequence:CCGGCCAGTCTCAAAGAATTGCTCACTCGAGTGAGCAATTCTTTGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033421.2-699s21c1
Sequence:GTACCGGTTTACTGCAGAGACCATTGCCCTCGAGGGCAATGGTCTCTGCAGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033421.2-1098s21c1
Sequence:GTACCGGGGCCTGGACAAACGTCAATCACTCGAGTGATTGACGTTTGTCCAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033421.2-360s21c1
Sequence:GTACCGGACGTCAGGAGAAGACGCAGAACTCGAGTTCTGCGTCTTCTCCTGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033421.2-186s21c1
Sequence:GTACCGGAGTCCAGAGGCCGAGCAGTTTCTCGAGAAACTGCTCGGCCTCTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033421.2-1032s21c1
Sequence:GTACCGGGACAAGAGCCTCCACCCTTTGCTCGAGCAAAGGGTGGAGGCTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033421
SNX21 MISSION shRNA Lentiviral Transduction Particles
sorting nexin family member 21
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033421.2-2676s1c1
Sequence:CCGGCCTCACTTCAAGGTTATCAATCTCGAGATTGATAACCTTGAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033421.2-521s1c1
Sequence:CCGGGCCCTCCAAGTACGTGCTCTACTCGAGTAGAGCACGTACTTGGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033421.2-836s1c1
Sequence:CCGGCCTCACCTGTACTGGCCTCTACTCGAGTAGAGGCCAGTACAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033421.2-431s1c1
Sequence:CCGGGCTGCAGGATTTCTGGAAGAACTCGAGTTCTTCCAGAAATCCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033421.2-1171s1c1
Sequence:CCGGCCAGTCTCAAAGAATTGCTCACTCGAGTGAGCAATTCTTTGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033421.2-699s21c1
Sequence:GTACCGGTTTACTGCAGAGACCATTGCCCTCGAGGGCAATGGTCTCTGCAGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033421.2-1098s21c1
Sequence:GTACCGGGGCCTGGACAAACGTCAATCACTCGAGTGATTGACGTTTGTCCAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033421.2-360s21c1
Sequence:GTACCGGACGTCAGGAGAAGACGCAGAACTCGAGTTCTGCGTCTTCTCCTGACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033421.2-186s21c1
Sequence:GTACCGGAGTCCAGAGGCCGAGCAGTTTCTCGAGAAACTGCTCGGCCTCTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033421.2-1032s21c1
Sequence:GTACCGGGACAAGAGCCTCCACCCTTTGCTCGAGCAAAGGGTGGAGGCTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks