EMAIL THIS PAGE TO A FRIEND

SNX22

sorting nexin 22

UniProtKB ID: Q96L94, Q9H844
Gene ID:
Human(79856) Summary: The protein encoded by this gene is a sorting nexin that is found in the cytoplasm, where it interacts with membrane-bound phosphatidylinositol 3-phosphate. The encoded protein may play a role in intracellular trafficking. Two transcript variants, one protein-coding and the other not protein-coding, have been found for this gene. [provided by RefSeq, Dec 2012]
Mouse(382083) sorting nexin 22
Rat(300796) sorting nexin 22
naked mole-rat(101705812) sorting nexin 22
cow(100125937) sorting nexin 22
sheep(101109803) sorting nexin 22
Zebrafish(561624) sorting nexin 22
Horse(100066854) sorting nexin 22
domestic cat(101088244) sorting nexin 22
dog(610689) sorting nexin 22
chicken(769119) sorting nexin 22
114 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA038470 Anti-SNX22 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024798 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024798 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024798 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001025612 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025612 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025612 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024798 Rosetta Predictions human pricing
NM_001106832 Rosetta Predictions rat pricing
NM_001025612 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024798 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101717 predicted 636
2 SASI_Hs01_00101723 predicted 579
3 SASI_Hs01_00101718 predicted 209
4 SASI_Hs02_00357345 predicted 425
5 SASI_Hs01_00101719 predicted 352
6 SASI_Hs01_00101720 predicted 805
7 SASI_Hs01_00101721 predicted 780
8 SASI_Hs01_00101722 predicted 760
9 SASI_Hs01_00101724 predicted 780
10 SASI_Hs01_00101725 predicted 119
11 SASI_Hs01_00101726 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106832 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222848 predicted 348
2 SASI_Rn02_00222849 predicted 552
3 SASI_Rn02_00222850 predicted 420
4 SASI_Rn02_00222851 predicted 349
5 SASI_Rn02_00222852 predicted 348
6 SASI_Rn02_00222853 predicted 326
7 SASI_Rn02_00222854 predicted 212
8 SASI_Rn02_00222855 predicted 369
9 SASI_Rn02_00222856 predicted 605
10 SASI_Rn02_00222857 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025612 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069208 predicted 699
2 SASI_Mm01_00069209 predicted 771
3 SASI_Mm02_00287978 predicted 847
4 SASI_Mm01_00069212 predicted 740
5 SASI_Mm01_00069213 predicted 211
6 SASI_Mm01_00069214 predicted 590
7 SASI_Mm01_00069215 predicted 329
8 SASI_Mm01_00069216 predicted 633
9 SASI_Mm01_00069217 predicted 380
10 SASI_Mm02_00287979 predicted 836
11 SASI_Mm01_00069210 predicted 872
12 SASI_Mm01_00069211 predicted 223
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024798
SNX22 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 22
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024798.2-805s21c1
Sequence:GTACCGGTAGCTGGAGGTGGTAGAATTTCTCGAGAAATTCTACCACCTCCAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024798.2-571s21c1
Sequence:GTACCGGTCAGCATCAGCCCAGATAAAGCTCGAGCTTTATCTGGGCTGATGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024798.2-639s21c1
Sequence:GTACCGGTGATCAGTCCAGAGGCCTTTGCTCGAGCAAAGGCCTCTGGACTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024798.2-206s21c1
Sequence:GTACCGGGCTGCACAAGCGGATCAAGAACTCGAGTTCTTGATCCGCTTGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024798.2-217s21c1
Sequence:GTACCGGGGATCAAGAAGCTGTACAAAGCTCGAGCTTTGTACAGCTTCTTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024798.2-315s21c1
Sequence:GTACCGGTACATCCAGGGCATCCTGTACCTCGAGGTACAGGATGCCCTGGATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024798.2-560s21c1
Sequence:GTACCGGCCTCTACAGCTTCAGCATCAGCTCGAGCTGATGCTGAAGCTGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024798.2-688s21c1
Sequence:GTACCGGTGTCCTATGAACTCCATATAACTCGAGTTATATGGAGTTCATAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024798.1-853s1c1
Sequence:CCGGGCAGGGTCAAGAAGATAAGTACTCGAGTACTTATCTTCTTGACCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024798.1-216s1c1
Sequence:CCGGCGGATCAAGAAGCTGTACAAACTCGAGTTTGTACAGCTTCTTGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151812    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024798.1-854s1c1
Sequence:CCGGCAGGGTCAAGAAGATAAGTAACTCGAGTTACTTATCTTCTTGACCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154480    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024798.1-1074s1c1
Sequence:CCGGGAGGTAGGAGAATCTCTCTTTCTCGAGAAAGAGAGATTCTCCTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024798
SNX22 MISSION shRNA shRNA Plasmid DNA
sorting nexin 22
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024798.2-805s21c1
Sequence:GTACCGGTAGCTGGAGGTGGTAGAATTTCTCGAGAAATTCTACCACCTCCAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024798.2-571s21c1
Sequence:GTACCGGTCAGCATCAGCCCAGATAAAGCTCGAGCTTTATCTGGGCTGATGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024798.2-639s21c1
Sequence:GTACCGGTGATCAGTCCAGAGGCCTTTGCTCGAGCAAAGGCCTCTGGACTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024798.2-206s21c1
Sequence:GTACCGGGCTGCACAAGCGGATCAAGAACTCGAGTTCTTGATCCGCTTGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024798.2-217s21c1
Sequence:GTACCGGGGATCAAGAAGCTGTACAAAGCTCGAGCTTTGTACAGCTTCTTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024798.2-315s21c1
Sequence:GTACCGGTACATCCAGGGCATCCTGTACCTCGAGGTACAGGATGCCCTGGATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024798.2-560s21c1
Sequence:GTACCGGCCTCTACAGCTTCAGCATCAGCTCGAGCTGATGCTGAAGCTGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024798.2-688s21c1
Sequence:GTACCGGTGTCCTATGAACTCCATATAACTCGAGTTATATGGAGTTCATAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024798.1-853s1c1
Sequence:CCGGGCAGGGTCAAGAAGATAAGTACTCGAGTACTTATCTTCTTGACCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024798.1-216s1c1
Sequence:CCGGCGGATCAAGAAGCTGTACAAACTCGAGTTTGTACAGCTTCTTGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151812    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024798.1-854s1c1
Sequence:CCGGCAGGGTCAAGAAGATAAGTAACTCGAGTTACTTATCTTCTTGACCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154480    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024798.1-1074s1c1
Sequence:CCGGGAGGTAGGAGAATCTCTCTTTCTCGAGAAAGAGAGATTCTCCTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024798
SNX22 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 22
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024798.2-805s21c1
Sequence:GTACCGGTAGCTGGAGGTGGTAGAATTTCTCGAGAAATTCTACCACCTCCAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024798.2-571s21c1
Sequence:GTACCGGTCAGCATCAGCCCAGATAAAGCTCGAGCTTTATCTGGGCTGATGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024798.2-639s21c1
Sequence:GTACCGGTGATCAGTCCAGAGGCCTTTGCTCGAGCAAAGGCCTCTGGACTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024798.2-206s21c1
Sequence:GTACCGGGCTGCACAAGCGGATCAAGAACTCGAGTTCTTGATCCGCTTGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024798.2-217s21c1
Sequence:GTACCGGGGATCAAGAAGCTGTACAAAGCTCGAGCTTTGTACAGCTTCTTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024798.2-315s21c1
Sequence:GTACCGGTACATCCAGGGCATCCTGTACCTCGAGGTACAGGATGCCCTGGATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024798.2-560s21c1
Sequence:GTACCGGCCTCTACAGCTTCAGCATCAGCTCGAGCTGATGCTGAAGCTGTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024798.2-688s21c1
Sequence:GTACCGGTGTCCTATGAACTCCATATAACTCGAGTTATATGGAGTTCATAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024798.1-853s1c1
Sequence:CCGGGCAGGGTCAAGAAGATAAGTACTCGAGTACTTATCTTCTTGACCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024798.1-216s1c1
Sequence:CCGGCGGATCAAGAAGCTGTACAAACTCGAGTTTGTACAGCTTCTTGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151812    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024798.1-854s1c1
Sequence:CCGGCAGGGTCAAGAAGATAAGTAACTCGAGTTACTTATCTTCTTGACCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154480    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024798.1-1074s1c1
Sequence:CCGGGAGGTAGGAGAATCTCTCTTTCTCGAGAAAGAGAGATTCTCCTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025612
SNX22 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 22
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025612.2-1057s21c1
Sequence:GTACCGGCACTCAGGACAGGTGTTATATCTCGAGATATAACACCTGTCCTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025612.2-843s21c1
Sequence:GTACCGGGAGAAAGGTGTGAGGTAATTTCTCGAGAAATTACCTCACACCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025612.2-209s21c1
Sequence:GTACCGGGGATCAAGAAACGGTACAAAGCTCGAGCTTTGTACCGTTTCTTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025612.2-1092s21c1
Sequence:GTACCGGAGCCCACACCCAAGCTATAAACTCGAGTTTATAGCTTGGGTGTGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025612.1-2030s1c1
Sequence:CCGGCCGAGGTTTAACCTCCACATTCTCGAGAATGTGGAGGTTAAACCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025612.1-208s1c1
Sequence:CCGGCGGATCAAGAAACGGTACAAACTCGAGTTTGTACCGTTTCTTGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025612.1-220s1c1
Sequence:CCGGCGGTACAAAGTGCCTGACTTTCTCGAGAAAGTCAGGCACTTTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025612.1-291s1c1
Sequence:CCGGGCAGGGATTAGAGACCTACATCTCGAGATGTAGGTCTCTAATCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025612.1-462s1c1
Sequence:CCGGGCCGGTCATTGGCTTCTGTATCTCGAGATACAGAAGCCAATGACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025612
SNX22 MISSION shRNA shRNA Plasmid DNA
sorting nexin 22
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025612.2-1057s21c1
Sequence:GTACCGGCACTCAGGACAGGTGTTATATCTCGAGATATAACACCTGTCCTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025612.2-843s21c1
Sequence:GTACCGGGAGAAAGGTGTGAGGTAATTTCTCGAGAAATTACCTCACACCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025612.2-209s21c1
Sequence:GTACCGGGGATCAAGAAACGGTACAAAGCTCGAGCTTTGTACCGTTTCTTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025612.2-1092s21c1
Sequence:GTACCGGAGCCCACACCCAAGCTATAAACTCGAGTTTATAGCTTGGGTGTGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025612.1-2030s1c1
Sequence:CCGGCCGAGGTTTAACCTCCACATTCTCGAGAATGTGGAGGTTAAACCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025612.1-208s1c1
Sequence:CCGGCGGATCAAGAAACGGTACAAACTCGAGTTTGTACCGTTTCTTGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025612.1-220s1c1
Sequence:CCGGCGGTACAAAGTGCCTGACTTTCTCGAGAAAGTCAGGCACTTTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025612.1-291s1c1
Sequence:CCGGGCAGGGATTAGAGACCTACATCTCGAGATGTAGGTCTCTAATCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025612.1-462s1c1
Sequence:CCGGGCCGGTCATTGGCTTCTGTATCTCGAGATACAGAAGCCAATGACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025612
SNX22 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 22
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025612.2-1057s21c1
Sequence:GTACCGGCACTCAGGACAGGTGTTATATCTCGAGATATAACACCTGTCCTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025612.2-843s21c1
Sequence:GTACCGGGAGAAAGGTGTGAGGTAATTTCTCGAGAAATTACCTCACACCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380061    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025612.2-209s21c1
Sequence:GTACCGGGGATCAAGAAACGGTACAAAGCTCGAGCTTTGTACCGTTTCTTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025612.2-1092s21c1
Sequence:GTACCGGAGCCCACACCCAAGCTATAAACTCGAGTTTATAGCTTGGGTGTGGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105665    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025612.1-2030s1c1
Sequence:CCGGCCGAGGTTTAACCTCCACATTCTCGAGAATGTGGAGGTTAAACCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025612.1-208s1c1
Sequence:CCGGCGGATCAAGAAACGGTACAAACTCGAGTTTGTACCGTTTCTTGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025612.1-220s1c1
Sequence:CCGGCGGTACAAAGTGCCTGACTTTCTCGAGAAAGTCAGGCACTTTGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025612.1-291s1c1
Sequence:CCGGGCAGGGATTAGAGACCTACATCTCGAGATGTAGGTCTCTAATCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025612.1-462s1c1
Sequence:CCGGGCCGGTCATTGGCTTCTGTATCTCGAGATACAGAAGCCAATGACCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks