EMAIL THIS PAGE TO A FRIEND

SNX24

sorting nexin 24

Synonyms: PRO1284
UniProtKB ID: Q9Y343, Q6UY33
Gene ID:
Mouse(69226) sorting nexing 24
Rat(361328) sorting nexin 24
Zebrafish(619249) sorting nexin 24
domestic cat(101083997) sorting nexin 24
dog(608666) sorting nexin 24
chicken(426798) sorting nexin 24
cow(614112) sorting nexin 24
sheep(101103475) sorting nexin 24
naked mole-rat(101721154) sorting nexin 24
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014035 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014035 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014035 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029394 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029394 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029394 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014035 Rosetta Predictions human pricing
NM_001008364 Rosetta Predictions rat pricing
NM_029394 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014035 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144057 predicted 1010
2 SASI_Hs02_00345026 predicted 978
3 SASI_Hs01_00144058 predicted 403
4 SASI_Hs01_00144059 predicted 634
5 SASI_Hs01_00144060 predicted 959
6 SASI_Hs01_00144061 predicted 959
7 SASI_Hs01_00144062 predicted 1010
8 SASI_Hs01_00144063 predicted 612
9 SASI_Hs01_00144064 predicted 539
10 SASI_Hs01_00144066 predicted 589
11 SASI_Hs01_00144065 predicted 550
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008364 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070818 predicted 983
2 SASI_Rn01_00070819 predicted 1238
3 SASI_Rn01_00070820 predicted 756
4 SASI_Rn01_00070821 predicted 965
5 SASI_Rn01_00070822 predicted 1044
6 SASI_Rn01_00070823 predicted 1001
7 SASI_Rn02_00199132 predicted 894
8 SASI_Rn01_00070824 predicted 726
9 SASI_Rn01_00070825 predicted 908
10 SASI_Rn02_00199133 predicted 939
11 SASI_Rn01_00070817 predicted 583
12 SASI_Rn01_00070826 predicted 1280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029394 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131063 predicted 994
2 SASI_Mm01_00131064 predicted 694
3 SASI_Mm01_00131065 predicted 200
4 SASI_Mm01_00131066 predicted 367
5 SASI_Mm01_00131068 predicted 301
6 SASI_Mm01_00131069 predicted 772
7 SASI_Mm01_00131070 predicted 836
8 SASI_Mm01_00131071 predicted 247
9 SASI_Mm02_00335291 predicted 998
10 SASI_Mm02_00335292 predicted 972
11 SASI_Mm01_00131067 predicted 728
12 SASI_Mm01_00131072 predicted 468
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014035
SNX24 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 24
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000135685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014035.1-384s1c1
Sequence:CCGGCAAAGGCAGAAAGTTGTGGATCTCGAGATCCACAACTTTCTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014035.1-224s1c1
Sequence:CCGGCCAGAAATCCCTTCTAAACATCTCGAGATGTTTAGAAGGGATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014035.1-1536s1c1
Sequence:CCGGGCCACAGGATTTCATGTTATTCTCGAGAATAACATGAAATCCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014035.1-895s1c1
Sequence:CCGGCGCACCATTTGCTAATTGAAACTCGAGTTTCAATTAGCAAATGGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014035.1-131s1c1
Sequence:CCGGGAAGTGCTAATGAATGGAAGACTCGAGTCTTCCATTCATTAGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014035.2-912s21c1
Sequence:GTACCGGTGTAGCTGCCAGCGTAGAAACCTCGAGGTTTCTACGCTGGCAGCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379674    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014035.2-775s21c1
Sequence:GTACCGGACAGCTCTAGCTAGTGGTAAACTCGAGTTTACCACTAGCTAGAGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014035.2-1096s21c1
Sequence:GTACCGGACTCTTCTCACCGTGAGATTTCTCGAGAAATCTCACGGTGAGAAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014035.2-1003s21c1
Sequence:GTACCGGAGTCGCACCATTTGCTAATTGCTCGAGCAATTAGCAAATGGTGCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014035.2-635s21c1
Sequence:GTACCGGGGAGTCCTCCATGGGATATTTCTCGAGAAATATCCCATGGAGGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014035
SNX24 MISSION shRNA shRNA Plasmid DNA
sorting nexin 24
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000135685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014035.1-384s1c1
Sequence:CCGGCAAAGGCAGAAAGTTGTGGATCTCGAGATCCACAACTTTCTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014035.1-224s1c1
Sequence:CCGGCCAGAAATCCCTTCTAAACATCTCGAGATGTTTAGAAGGGATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014035.1-1536s1c1
Sequence:CCGGGCCACAGGATTTCATGTTATTCTCGAGAATAACATGAAATCCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014035.1-895s1c1
Sequence:CCGGCGCACCATTTGCTAATTGAAACTCGAGTTTCAATTAGCAAATGGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014035.1-131s1c1
Sequence:CCGGGAAGTGCTAATGAATGGAAGACTCGAGTCTTCCATTCATTAGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014035.2-912s21c1
Sequence:GTACCGGTGTAGCTGCCAGCGTAGAAACCTCGAGGTTTCTACGCTGGCAGCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379674    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014035.2-775s21c1
Sequence:GTACCGGACAGCTCTAGCTAGTGGTAAACTCGAGTTTACCACTAGCTAGAGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014035.2-1096s21c1
Sequence:GTACCGGACTCTTCTCACCGTGAGATTTCTCGAGAAATCTCACGGTGAGAAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014035.2-1003s21c1
Sequence:GTACCGGAGTCGCACCATTTGCTAATTGCTCGAGCAATTAGCAAATGGTGCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014035.2-635s21c1
Sequence:GTACCGGGGAGTCCTCCATGGGATATTTCTCGAGAAATATCCCATGGAGGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014035
SNX24 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 24
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000135685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014035.1-384s1c1
Sequence:CCGGCAAAGGCAGAAAGTTGTGGATCTCGAGATCCACAACTTTCTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014035.1-224s1c1
Sequence:CCGGCCAGAAATCCCTTCTAAACATCTCGAGATGTTTAGAAGGGATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134280    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014035.1-1536s1c1
Sequence:CCGGGCCACAGGATTTCATGTTATTCTCGAGAATAACATGAAATCCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014035.1-895s1c1
Sequence:CCGGCGCACCATTTGCTAATTGAAACTCGAGTTTCAATTAGCAAATGGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014035.1-131s1c1
Sequence:CCGGGAAGTGCTAATGAATGGAAGACTCGAGTCTTCCATTCATTAGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014035.2-912s21c1
Sequence:GTACCGGTGTAGCTGCCAGCGTAGAAACCTCGAGGTTTCTACGCTGGCAGCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379674    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014035.2-775s21c1
Sequence:GTACCGGACAGCTCTAGCTAGTGGTAAACTCGAGTTTACCACTAGCTAGAGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014035.2-1096s21c1
Sequence:GTACCGGACTCTTCTCACCGTGAGATTTCTCGAGAAATCTCACGGTGAGAAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014035.2-1003s21c1
Sequence:GTACCGGAGTCGCACCATTTGCTAATTGCTCGAGCAATTAGCAAATGGTGCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014035.2-635s21c1
Sequence:GTACCGGGGAGTCCTCCATGGGATATTTCTCGAGAAATATCCCATGGAGGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029394
VALIDATED
SNX24 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 24
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029394.2-451s1c1
Sequence:CCGGCCTCTCTACCGAAAGCAGAAACTCGAGTTTCTGCTTTCGGTAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029394.2-373s1c1
Sequence:CCGGCGTATTTACAGGCCGTCATTTCTCGAGAAATGACGGCCTGTAAATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191184    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029394.2-1149s1c1
Sequence:CCGGCCAGTTATACTGACAGTAGAACTCGAGTTCTACTGTCAGTATAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029394.2-472s1c1
Sequence:CCGGGCTGTGGATCTTTCGATGAGACTCGAGTCTCATCGAAAGATCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029394.2-588s1c1
Sequence:CCGGGTGGTCATCGAAGGAGTTCTTCTCGAGAAGAACTCCTTCGATGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029394.2-786s1c1
Sequence:CCGGGCAGGGACATTTCTATTAGAACTCGAGTTCTAATAGAAATGTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200495    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029394.2-1566s1c1
Sequence:CCGGCGTATGGATTAAAGTGAGTTACTCGAGTAACTCACTTTAATCCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029394.3-442s21c1
Sequence:CCGGACTTGCCCTCTCTACCGAAAGCTCGAGCTTTCGGTAGAGAGGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029394.3-698s21c1
Sequence:CCGGTCGATATCTCTACCAAGTTAACTCGAGTTAACTTGGTAGAGATATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029394.3-357s21c1
Sequence:CCGGCAAGGCCTGGAAACGTATTTACTCGAGTAAATACGTTTCCAGGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029394.3-180s21c1
Sequence:CCGGCGCGGCTACACGGTGTTTAAACTCGAGTTTAAACACCGTGTAGCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029394.3-1133s21c1
Sequence:CCGGCCGGTCTGAGGATCCAGTTATCTCGAGATAACTGGATCCTCAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029394
VALIDATED
SNX24 MISSION shRNA shRNA Plasmid DNA
sorting nexin 24
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029394.2-451s1c1
Sequence:CCGGCCTCTCTACCGAAAGCAGAAACTCGAGTTTCTGCTTTCGGTAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029394.2-373s1c1
Sequence:CCGGCGTATTTACAGGCCGTCATTTCTCGAGAAATGACGGCCTGTAAATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191184    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029394.2-1149s1c1
Sequence:CCGGCCAGTTATACTGACAGTAGAACTCGAGTTCTACTGTCAGTATAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029394.2-472s1c1
Sequence:CCGGGCTGTGGATCTTTCGATGAGACTCGAGTCTCATCGAAAGATCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029394.2-588s1c1
Sequence:CCGGGTGGTCATCGAAGGAGTTCTTCTCGAGAAGAACTCCTTCGATGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029394.2-786s1c1
Sequence:CCGGGCAGGGACATTTCTATTAGAACTCGAGTTCTAATAGAAATGTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200495    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029394.2-1566s1c1
Sequence:CCGGCGTATGGATTAAAGTGAGTTACTCGAGTAACTCACTTTAATCCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029394.3-442s21c1
Sequence:CCGGACTTGCCCTCTCTACCGAAAGCTCGAGCTTTCGGTAGAGAGGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029394.3-698s21c1
Sequence:CCGGTCGATATCTCTACCAAGTTAACTCGAGTTAACTTGGTAGAGATATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029394.3-357s21c1
Sequence:CCGGCAAGGCCTGGAAACGTATTTACTCGAGTAAATACGTTTCCAGGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029394.3-180s21c1
Sequence:CCGGCGCGGCTACACGGTGTTTAAACTCGAGTTTAAACACCGTGTAGCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029394.3-1133s21c1
Sequence:CCGGCCGGTCTGAGGATCCAGTTATCTCGAGATAACTGGATCCTCAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029394
VALIDATED
SNX24 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 24
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029394.2-451s1c1
Sequence:CCGGCCTCTCTACCGAAAGCAGAAACTCGAGTTTCTGCTTTCGGTAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029394.2-373s1c1
Sequence:CCGGCGTATTTACAGGCCGTCATTTCTCGAGAAATGACGGCCTGTAAATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191184    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029394.2-1149s1c1
Sequence:CCGGCCAGTTATACTGACAGTAGAACTCGAGTTCTACTGTCAGTATAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029394.2-472s1c1
Sequence:CCGGGCTGTGGATCTTTCGATGAGACTCGAGTCTCATCGAAAGATCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029394.2-588s1c1
Sequence:CCGGGTGGTCATCGAAGGAGTTCTTCTCGAGAAGAACTCCTTCGATGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029394.2-786s1c1
Sequence:CCGGGCAGGGACATTTCTATTAGAACTCGAGTTCTAATAGAAATGTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200495    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029394.2-1566s1c1
Sequence:CCGGCGTATGGATTAAAGTGAGTTACTCGAGTAACTCACTTTAATCCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029394.3-442s21c1
Sequence:CCGGACTTGCCCTCTCTACCGAAAGCTCGAGCTTTCGGTAGAGAGGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029394.3-698s21c1
Sequence:CCGGTCGATATCTCTACCAAGTTAACTCGAGTTAACTTGGTAGAGATATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029394.3-357s21c1
Sequence:CCGGCAAGGCCTGGAAACGTATTTACTCGAGTAAATACGTTTCCAGGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029394.3-180s21c1
Sequence:CCGGCGCGGCTACACGGTGTTTAAACTCGAGTTTAAACACCGTGTAGCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029394.3-1133s21c1
Sequence:CCGGCCGGTCTGAGGATCCAGTTATCTCGAGATAACTGGATCCTCAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks