EMAIL THIS PAGE TO A FRIEND

SNX25

sorting nexin 25

Synonyms: SBBI31
UniProtKB ID: Q9H3E2, Q3ZT30
Gene ID:
Mouse(102141) sorting nexin 25
Rat(306471) sorting nexin 25
naked mole-rat(101707851) sorting nexin 25
cow(533174) sorting nexin 25
sheep(101112024) sorting nexin 25
Zebrafish(793657) sorting nexin 25
chicken(422544) sorting nexin 25
Horse(100057495) sorting nexin 25
domestic cat(101091615) sorting nexin 25
dog(475629) sorting nexin 25
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031953 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031953 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031953 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207213 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207213 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207213 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031953 Rosetta Predictions human pricing
XM_001061047 Rosetta Predictions rat pricing
XM_224863 Rosetta Predictions rat pricing
NM_207213 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031953 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359122 predicted 772
2 SASI_Hs01_00039865 predicted 378
3 SASI_Hs02_00359123 predicted 488
4 SASI_Hs01_00039867 predicted 343
5 SASI_Hs01_00039868 predicted 1793
6 SASI_Hs01_00039869 predicted 1768
7 SASI_Hs01_00039870 predicted 1375
8 SASI_Hs02_00359124 predicted 1029
9 SASI_Hs01_00039872 predicted 366
10 SASI_Hs01_00039874 predicted 869
11 SASI_Hs01_00039866 predicted 537
12 SASI_Hs01_00039871 predicted 1763
13 SASI_Hs01_00039873 predicted 2608
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061047 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00298618 predicted 1219
2 SASI_Rn02_00298619 predicted 1106
3 SASI_Rn02_00298620 predicted 2107
4 SASI_Rn02_00298621 predicted 833
5 SASI_Rn02_00298622 predicted 2664
6 SASI_Rn02_00298623 predicted 997
7 SASI_Rn02_00298624 predicted 2506
8 SASI_Rn02_00298625 predicted 618
9 SASI_Rn02_00298626 predicted 1375
10 SASI_Rn02_00298627 predicted 1697
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224863 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382326 predicted 1452
2 SASI_Rn02_00382327 predicted 1330
3 SASI_Rn02_00382328 predicted 2341
4 SASI_Rn02_00382329 predicted 1062
5 SASI_Rn02_00382330 predicted 2893
6 SASI_Rn02_00382331 predicted 1221
7 SASI_Rn02_00382332 predicted 2728
8 SASI_Rn02_00382333 predicted 839
9 SASI_Rn02_00382334 predicted 1609
10 SASI_Rn02_00382335 predicted 1924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207213 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037594 predicted 1145
2 SASI_Mm01_00037595 predicted 655
3 SASI_Mm01_00037596 predicted 2352
4 SASI_Mm01_00037597 predicted 306
5 SASI_Mm01_00037599 predicted 1281
6 SASI_Mm01_00037600 predicted 1861
7 SASI_Mm01_00037601 predicted 1716
8 SASI_Mm01_00037602 predicted 1039
9 SASI_Mm02_00351935 predicted 266
10 SASI_Mm01_00037603 predicted 877
11 SASI_Mm01_00037598 predicted 1858
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031953
VALIDATED
SNX25 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 25
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031953.2-1184s21c1
Sequence:GTACCGGCACAATTAGTTGGTGAAATTTCTCGAGAAATTTCACCAACTAATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031953.2-1332s21c1
Sequence:CCGGGACCCTAAAGGATAGGTATTACTCGAGTAATACCTATCCTTTAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031953.2-2787s21c1
Sequence:CCGGGGCTTAACTGAGAACCGTATTCTCGAGAATACGGTTCTCAGTTAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031953.2-777s21c1
Sequence:GTACCGGGAAGCAACTAAGGTATCAAATCTCGAGATTTGATACCTTAGTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031953.2-2062s21c1
Sequence:CCGGCCTGACTACCTCAAGGTTATCCTCGAGGATAACCTTGAGGTAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031953.2-555s21c1
Sequence:CCGGGTCTCTCAGCTTACGTATAATCTCGAGATTATACGTAAGCTGAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031953.2-1183s1c1
Sequence:CCGGCCACAATTAGTTGGTGAAATTCTCGAGAATTTCACCAACTAATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183563    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031953.2-3059s1c1
Sequence:CCGGGAGGACTGTGAACATTCTTATCTCGAGATAAGAATGTTCACAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148091    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031953.2-2972s1c1
Sequence:CCGGGTGAGAACCTAGGAAGTATTTCTCGAGAAATACTTCCTAGGTTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031953.2-1771s1c1
Sequence:CCGGCCATGTTACTTTGTCATGGTACTCGAGTACCATGACAAAGTAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031953.2-381s1c1
Sequence:CCGGGAGGACTTTACTCACTCATTTCTCGAGAAATGAGTGAGTAAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_031953.2-232s1c1
Sequence:CCGGGATTACATTCTGTCCTGGTATCTCGAGATACCAGGACAGAATGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031953
VALIDATED
SNX25 MISSION shRNA shRNA Plasmid DNA
sorting nexin 25
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031953.2-1184s21c1
Sequence:GTACCGGCACAATTAGTTGGTGAAATTTCTCGAGAAATTTCACCAACTAATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031953.2-1332s21c1
Sequence:CCGGGACCCTAAAGGATAGGTATTACTCGAGTAATACCTATCCTTTAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031953.2-2787s21c1
Sequence:CCGGGGCTTAACTGAGAACCGTATTCTCGAGAATACGGTTCTCAGTTAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031953.2-777s21c1
Sequence:GTACCGGGAAGCAACTAAGGTATCAAATCTCGAGATTTGATACCTTAGTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031953.2-2062s21c1
Sequence:CCGGCCTGACTACCTCAAGGTTATCCTCGAGGATAACCTTGAGGTAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031953.2-555s21c1
Sequence:CCGGGTCTCTCAGCTTACGTATAATCTCGAGATTATACGTAAGCTGAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031953.2-1183s1c1
Sequence:CCGGCCACAATTAGTTGGTGAAATTCTCGAGAATTTCACCAACTAATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183563    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031953.2-3059s1c1
Sequence:CCGGGAGGACTGTGAACATTCTTATCTCGAGATAAGAATGTTCACAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148091    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031953.2-2972s1c1
Sequence:CCGGGTGAGAACCTAGGAAGTATTTCTCGAGAAATACTTCCTAGGTTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031953.2-1771s1c1
Sequence:CCGGCCATGTTACTTTGTCATGGTACTCGAGTACCATGACAAAGTAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031953.2-381s1c1
Sequence:CCGGGAGGACTTTACTCACTCATTTCTCGAGAAATGAGTGAGTAAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_031953.2-232s1c1
Sequence:CCGGGATTACATTCTGTCCTGGTATCTCGAGATACCAGGACAGAATGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031953
VALIDATED
SNX25 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 25
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031953.2-1184s21c1
Sequence:GTACCGGCACAATTAGTTGGTGAAATTTCTCGAGAAATTTCACCAACTAATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031953.2-1332s21c1
Sequence:CCGGGACCCTAAAGGATAGGTATTACTCGAGTAATACCTATCCTTTAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031953.2-2787s21c1
Sequence:CCGGGGCTTAACTGAGAACCGTATTCTCGAGAATACGGTTCTCAGTTAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031953.2-777s21c1
Sequence:GTACCGGGAAGCAACTAAGGTATCAAATCTCGAGATTTGATACCTTAGTTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031953.2-2062s21c1
Sequence:CCGGCCTGACTACCTCAAGGTTATCCTCGAGGATAACCTTGAGGTAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031953.2-555s21c1
Sequence:CCGGGTCTCTCAGCTTACGTATAATCTCGAGATTATACGTAAGCTGAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183758    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031953.2-1183s1c1
Sequence:CCGGCCACAATTAGTTGGTGAAATTCTCGAGAATTTCACCAACTAATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183563    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031953.2-3059s1c1
Sequence:CCGGGAGGACTGTGAACATTCTTATCTCGAGATAAGAATGTTCACAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148091    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031953.2-2972s1c1
Sequence:CCGGGTGAGAACCTAGGAAGTATTTCTCGAGAAATACTTCCTAGGTTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031953.2-1771s1c1
Sequence:CCGGCCATGTTACTTTGTCATGGTACTCGAGTACCATGACAAAGTAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031953.2-381s1c1
Sequence:CCGGGAGGACTTTACTCACTCATTTCTCGAGAAATGAGTGAGTAAAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_031953.2-232s1c1
Sequence:CCGGGATTACATTCTGTCCTGGTATCTCGAGATACCAGGACAGAATGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207213
VALIDATED
SNX25 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 25
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207213.1-2382s21c1
Sequence:CCGGATGGGTGCGAAGAACATTAATCTCGAGATTAATGTTCTTCGCACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207213.1-313s21c1
Sequence:CCGGTACAGTTACAGAGACTATATTCTCGAGAATATAGTCTCTGTAACTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207213.1-2962s21c1
Sequence:CCGGCAGATGCTGTGGTAGGCAATACTCGAGTATTGCCTACCACAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207213.1-660s21c1
Sequence:CCGGACGTACAATGCTCGCAGAAATCTCGAGATTTCTGCGAGCATTGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207213.1-1425s21c1
Sequence:CCGGGGTGCTGAGGGATCGGTATTACTCGAGTAATACCGATCCCTCAGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207213.1-1663s1c1
Sequence:CCGGGCTCTAAGTTCTATTCAGAATCTCGAGATTCTGAATAGAACTTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192115    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207213.1-2824s1c1
Sequence:CCGGCCAGAGAAATGTCTGTGTAAACTCGAGTTTACACAGACATTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207213.1-672s1c1
Sequence:CCGGCGCAGAAATTCTTACGACAAACTCGAGTTTGTCGTAAGAATTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207213
VALIDATED
SNX25 MISSION shRNA shRNA Plasmid DNA
sorting nexin 25
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207213.1-2382s21c1
Sequence:CCGGATGGGTGCGAAGAACATTAATCTCGAGATTAATGTTCTTCGCACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207213.1-313s21c1
Sequence:CCGGTACAGTTACAGAGACTATATTCTCGAGAATATAGTCTCTGTAACTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207213.1-2962s21c1
Sequence:CCGGCAGATGCTGTGGTAGGCAATACTCGAGTATTGCCTACCACAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207213.1-660s21c1
Sequence:CCGGACGTACAATGCTCGCAGAAATCTCGAGATTTCTGCGAGCATTGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207213.1-1425s21c1
Sequence:CCGGGGTGCTGAGGGATCGGTATTACTCGAGTAATACCGATCCCTCAGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207213.1-1663s1c1
Sequence:CCGGGCTCTAAGTTCTATTCAGAATCTCGAGATTCTGAATAGAACTTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192115    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207213.1-2824s1c1
Sequence:CCGGCCAGAGAAATGTCTGTGTAAACTCGAGTTTACACAGACATTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207213.1-672s1c1
Sequence:CCGGCGCAGAAATTCTTACGACAAACTCGAGTTTGTCGTAAGAATTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207213
VALIDATED
SNX25 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 25
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207213.1-2382s21c1
Sequence:CCGGATGGGTGCGAAGAACATTAATCTCGAGATTAATGTTCTTCGCACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207213.1-313s21c1
Sequence:CCGGTACAGTTACAGAGACTATATTCTCGAGAATATAGTCTCTGTAACTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253170    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207213.1-2962s21c1
Sequence:CCGGCAGATGCTGTGGTAGGCAATACTCGAGTATTGCCTACCACAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207213.1-660s21c1
Sequence:CCGGACGTACAATGCTCGCAGAAATCTCGAGATTTCTGCGAGCATTGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207213.1-1425s21c1
Sequence:CCGGGGTGCTGAGGGATCGGTATTACTCGAGTAATACCGATCCCTCAGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207213.1-1663s1c1
Sequence:CCGGGCTCTAAGTTCTATTCAGAATCTCGAGATTCTGAATAGAACTTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192115    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_207213.1-2824s1c1
Sequence:CCGGCCAGAGAAATGTCTGTGTAAACTCGAGTTTACACAGACATTTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207213.1-672s1c1
Sequence:CCGGCGCAGAAATTCTTACGACAAACTCGAGTTTGTCGTAAGAATTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks