EMAIL THIS PAGE TO A FRIEND

SNX27

sorting nexin family member 27

Synonyms: MRT1 MY014
Gene ID:
Human(81609) Summary: This gene encodes a member of the sorting nexin family, a diverse group of cytoplasmic and membrane-associated proteins involved in endocytosis of plasma membrane receptors and protein trafficking through these compartments. All members of this protein family contain a phosphoinositide binding domain (PX domain). A highly similar protein in mouse is responsible for the specific recruitment of an isoform of serotonin 5-hydroxytryptamine 4 receptor into early endosomes, suggesting the analogous role for the human protein. [provided by RefSeq, Jul 2008]
Mouse(76742) sorting nexin family member 27
Rat(260323) sorting nexin family member 27
domestic guinea pig(100734207) sorting nexin family member 27
naked mole-rat(101725173) sorting nexin family member 27
Domestic Rabbit(100328676) sorting nexin family member 27
cow(513214) sorting nexin family member 27
sheep(101118328) sorting nexin family member 27
chicken(425666) sorting nexin family member 27
domestic cat(101084302) sorting nexin family member 27
dog(483200) sorting nexin family member 27
281 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030918 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030918 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030918 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001082484 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001082484 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001082484 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030918 Rosetta Predictions human pricing
NM_001110151 Rosetta Predictions rat pricing
NM_152847 Rosetta Predictions rat pricing
NM_001082484 Rosetta Predictions mouse pricing
NM_029721 Rosetta Predictions mouse pricing
XM_131051 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139923 predicted 1031
2 SASI_Hs01_00139924 predicted 1008
3 SASI_Hs01_00139925 predicted 1608
4 SASI_Hs01_00139926 predicted 719
5 SASI_Hs01_00139927 predicted 797
6 SASI_Hs01_00139930 predicted 743
7 SASI_Hs02_00358462 predicted 1586
8 SASI_Hs02_00358463 predicted 999
9 SASI_Hs02_00358464 predicted 1206
10 SASI_Hs02_00358465 predicted 1333
11 SASI_Hs01_00139922 predicted 642
12 SASI_Hs01_00139928 predicted 1277
13 SASI_Hs01_00139929 predicted 1182
14 SASI_Hs01_00139931 predicted 960
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110151 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251072 predicted 1240
2 SASI_Rn02_00251073 predicted 739
3 SASI_Rn02_00251074 predicted 632
4 SASI_Rn02_00251075 predicted 491
5 SASI_Rn02_00251076 predicted 1060
6 SASI_Rn02_00251077 predicted 1111
7 SASI_Rn02_00251078 predicted 964
8 SASI_Rn02_00251079 predicted 911
9 SASI_Rn02_00251080 predicted 1120
10 SASI_Rn02_00251081 predicted 1080
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152847 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268911 predicted 1244
2 SASI_Rn01_00051757 predicted 734
3 SASI_Rn02_00268912 predicted 631
4 SASI_Rn01_00051758 predicted 491
5 SASI_Rn02_00268913 predicted 1066
6 SASI_Rn01_00051759 predicted 1114
7 SASI_Rn01_00051760 predicted 964
8 SASI_Rn01_00051763 predicted 907
9 SASI_Rn01_00051764 predicted 1128
10 SASI_Rn01_00051766 predicted 1077
11 SASI_Rn01_00051761 predicted 772
12 SASI_Rn01_00051762 predicted 748
13 SASI_Rn01_00051765 predicted 1600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082484 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299272 predicted 1273
2 SASI_Mm02_00299273 predicted 521
3 SASI_Mm02_00299274 predicted 1142
4 SASI_Mm02_00299275 predicted 770
5 SASI_Mm02_00299276 predicted 782
6 SASI_Mm02_00299277 predicted 1088
7 SASI_Mm02_00299278 predicted 895
8 SASI_Mm02_00299279 predicted 1487
9 SASI_Mm02_00299280 predicted 1071
10 SASI_Mm02_00299281 predicted 1407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029721 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335801 predicted 1276
2 SASI_Mm02_00335802 predicted 518
3 SASI_Mm02_00335803 predicted 1139
4 SASI_Mm02_00335804 predicted 770
5 SASI_Mm02_00335805 predicted 778
6 SASI_Mm02_00335806 predicted 1086
7 SASI_Mm02_00335807 predicted 889
8 SASI_Mm02_00335808 predicted 1488
9 SASI_Mm02_00335809 predicted 1069
10 SASI_Mm02_00335810 predicted 1408
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_131051 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00257606 predicted 1308
2 SASI_Mm01_00257607 predicted 548
3 SASI_Mm01_00257608 predicted 1131
4 SASI_Mm01_00257609 predicted 1176
5 SASI_Mm01_00257610 predicted 798
6 SASI_Mm01_00257611 predicted 807
7 SASI_Mm01_00257612 predicted 1114
8 SASI_Mm01_00257613 predicted 1522
9 SASI_Mm01_00257614 predicted 1100
10 SASI_Mm01_00257615 predicted 1437
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030918
VALIDATED
SNX27 MISSION shRNA Bacterial Glycerol Stock
sorting nexin family member 27
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030918.4-6157s1c1
Sequence:CCGGGCCCATTTAGTTTCATCCTTTCTCGAGAAAGGATGAAACTAAATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030918.4-1212s1c1
Sequence:CCGGCCTATCAATTACAGAAGCTATCTCGAGATAGCTTCTGTAATTGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_030918.4-1525s1c1
Sequence:CCGGCACGCCATATTTCAATTACATCTCGAGATGTAATTGAAATATGGCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030918.4-870s1c1
Sequence:CCGGCAACGGTTACAGTCAGGGTTACTCGAGTAACCCTGACTGTAACCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030918.4-752s1c1
Sequence:CCGGGTGTGTTCAATACGAGTAATTCTCGAGAATTACTCGTATTGAACACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030918.5-2818s21c1
Sequence:CCGGCAAATTAGCTGCACGTATATACTCGAGTATATACGTGCAGCTAATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030918.5-1599s21c1
Sequence:CCGGATTAGTTAGAGACTGATTATCCTCGAGGATAATCAGTCTCTAACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030918.5-1466s21c1
Sequence:CCGGATGGCCTTCTGTTTCGAATATCTCGAGATATTCGAAACAGAAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030918.5-1002s21c1
Sequence:CCGGTACGTAAATTGGCACCTAATGCTCGAGCATTAGGTGCCAATTTACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030918.5-899s21c1
Sequence:CCGGAGTACTACAGACCAAGTATATCTCGAGATATACTTGGTCTGTAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030918
VALIDATED
SNX27 MISSION shRNA shRNA Plasmid DNA
sorting nexin family member 27
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030918.4-6157s1c1
Sequence:CCGGGCCCATTTAGTTTCATCCTTTCTCGAGAAAGGATGAAACTAAATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030918.4-1212s1c1
Sequence:CCGGCCTATCAATTACAGAAGCTATCTCGAGATAGCTTCTGTAATTGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_030918.4-1525s1c1
Sequence:CCGGCACGCCATATTTCAATTACATCTCGAGATGTAATTGAAATATGGCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030918.4-870s1c1
Sequence:CCGGCAACGGTTACAGTCAGGGTTACTCGAGTAACCCTGACTGTAACCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030918.4-752s1c1
Sequence:CCGGGTGTGTTCAATACGAGTAATTCTCGAGAATTACTCGTATTGAACACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030918.5-2818s21c1
Sequence:CCGGCAAATTAGCTGCACGTATATACTCGAGTATATACGTGCAGCTAATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030918.5-1599s21c1
Sequence:CCGGATTAGTTAGAGACTGATTATCCTCGAGGATAATCAGTCTCTAACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030918.5-1466s21c1
Sequence:CCGGATGGCCTTCTGTTTCGAATATCTCGAGATATTCGAAACAGAAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030918.5-1002s21c1
Sequence:CCGGTACGTAAATTGGCACCTAATGCTCGAGCATTAGGTGCCAATTTACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030918.5-899s21c1
Sequence:CCGGAGTACTACAGACCAAGTATATCTCGAGATATACTTGGTCTGTAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030918
VALIDATED
SNX27 MISSION shRNA Lentiviral Transduction Particles
sorting nexin family member 27
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005722    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030918.4-6157s1c1
Sequence:CCGGGCCCATTTAGTTTCATCCTTTCTCGAGAAAGGATGAAACTAAATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030918.4-1212s1c1
Sequence:CCGGCCTATCAATTACAGAAGCTATCTCGAGATAGCTTCTGTAATTGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_030918.4-1525s1c1
Sequence:CCGGCACGCCATATTTCAATTACATCTCGAGATGTAATTGAAATATGGCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030918.4-870s1c1
Sequence:CCGGCAACGGTTACAGTCAGGGTTACTCGAGTAACCCTGACTGTAACCGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_030918.4-752s1c1
Sequence:CCGGGTGTGTTCAATACGAGTAATTCTCGAGAATTACTCGTATTGAACACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245095    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030918.5-2818s21c1
Sequence:CCGGCAAATTAGCTGCACGTATATACTCGAGTATATACGTGCAGCTAATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030918.5-1599s21c1
Sequence:CCGGATTAGTTAGAGACTGATTATCCTCGAGGATAATCAGTCTCTAACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030918.5-1466s21c1
Sequence:CCGGATGGCCTTCTGTTTCGAATATCTCGAGATATTCGAAACAGAAGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030918.5-1002s21c1
Sequence:CCGGTACGTAAATTGGCACCTAATGCTCGAGCATTAGGTGCCAATTTACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030918.5-899s21c1
Sequence:CCGGAGTACTACAGACCAAGTATATCTCGAGATATACTTGGTCTGTAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001082484
VALIDATED
SNX27 MISSION shRNA Bacterial Glycerol Stock
sorting nexin family member 27
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001082484.1-1407s21c1
Sequence:CCGGCTGCGAGGGCTACAATGAAATCTCGAGATTTCATTGTAGCCCTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001082484.1-1147s21c1
Sequence:CCGGCCTAATGAATTTCCTCATAAACTCGAGTTTATGAGGAAATTCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001082484.1-1107s21c1
Sequence:CCGGATTTGAAGTGATCAATCATTCCTCGAGGAATGATTGATCACTTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001082484.1-1529s21c1
Sequence:CCGGAGCTGGAGAACCAGGTAATAGCTCGAGCTATTACCTGGTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253472    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001082484.1-2114s21c1
Sequence:CCGGTGCACTGTTCAAGCATATATACTCGAGTATATATGCTTGAACAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001082484
VALIDATED
SNX27 MISSION shRNA shRNA Plasmid DNA
sorting nexin family member 27
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001082484.1-1407s21c1
Sequence:CCGGCTGCGAGGGCTACAATGAAATCTCGAGATTTCATTGTAGCCCTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001082484.1-1147s21c1
Sequence:CCGGCCTAATGAATTTCCTCATAAACTCGAGTTTATGAGGAAATTCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001082484.1-1107s21c1
Sequence:CCGGATTTGAAGTGATCAATCATTCCTCGAGGAATGATTGATCACTTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001082484.1-1529s21c1
Sequence:CCGGAGCTGGAGAACCAGGTAATAGCTCGAGCTATTACCTGGTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253472    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001082484.1-2114s21c1
Sequence:CCGGTGCACTGTTCAAGCATATATACTCGAGTATATATGCTTGAACAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001082484
VALIDATED
SNX27 MISSION shRNA Lentiviral Transduction Particles
sorting nexin family member 27
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001082484.1-1407s21c1
Sequence:CCGGCTGCGAGGGCTACAATGAAATCTCGAGATTTCATTGTAGCCCTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001082484.1-1147s21c1
Sequence:CCGGCCTAATGAATTTCCTCATAAACTCGAGTTTATGAGGAAATTCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001082484.1-1107s21c1
Sequence:CCGGATTTGAAGTGATCAATCATTCCTCGAGGAATGATTGATCACTTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001082484.1-1529s21c1
Sequence:CCGGAGCTGGAGAACCAGGTAATAGCTCGAGCTATTACCTGGTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253472    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001082484.1-2114s21c1
Sequence:CCGGTGCACTGTTCAAGCATATATACTCGAGTATATATGCTTGAACAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks