EMAIL THIS PAGE TO A FRIEND

SNX29

sorting nexin 29

Synonyms: A-388D4.1 RUNDC2A
UniProtKB ID: Q8TEQ0, B5MDW2, Q8N2X2, Q9HA26
Gene ID:
Mouse(74478) sorting nexin 29
Rat(689142) sorting nexin 29
Zebrafish(565513) sorting nexin 29
chicken(416417) sorting nexin 29
dog(479845) sorting nexin 29
cow(518366) sorting nexin 29
sheep(101109141) sorting nexin 29
naked mole-rat(101720339) sorting nexin 29
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080530 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080530 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080530 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028964 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028964 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028964 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001009607 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001009607 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001009607 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU032101 MISSION® esiRNA esiRNA targeting mouse Snx29 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080530 Rosetta Predictions human pricing
XM_929500 Rosetta Predictions human pricing
NM_001109526 Rosetta Predictions rat pricing
NM_028964 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080530 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315737 predicted 491
2 SASI_Hs02_00315738 predicted 914
3 SASI_Hs02_00315739 predicted 1097
4 SASI_Hs02_00315740 predicted 989
5 SASI_Hs02_00315741 predicted 371
6 SASI_Hs02_00315742 predicted 682
7 SASI_Hs02_00315743 predicted 913
8 SASI_Hs02_00315744 predicted 1029
9 SASI_Hs02_00315745 predicted 608
10 SASI_Hs02_00315746 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929500 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00272590 predicted 282
2 SASI_Hs01_00272591 predicted 268
3 SASI_Hs01_00272592 predicted 234
4 SASI_Hs01_00272593 predicted 313
5 SASI_Hs01_00272594 predicted 310
6 SASI_Hs01_00272595 predicted 229
7 SASI_Hs01_00272596 predicted 303
8 SASI_Hs01_00272597 predicted 215
9 SASI_Hs01_00272598 predicted 313
10 SASI_Hs01_00272599 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109526 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249269 predicted 777
2 SASI_Rn02_00249270 predicted 219
3 SASI_Rn02_00249271 predicted 687
4 SASI_Rn02_00249272 predicted 501
5 SASI_Rn02_00249273 predicted 1226
6 SASI_Rn02_00249274 predicted 374
7 SASI_Rn02_00249275 predicted 803
8 SASI_Rn02_00249276 predicted 702
9 SASI_Rn02_00249277 predicted 1243
10 SASI_Rn02_00249278 predicted 1051
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028964 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091404 predicted 770
2 SASI_Mm01_00091405 predicted 1390
3 SASI_Mm01_00091407 predicted 290
4 SASI_Mm01_00091408 predicted 221
5 SASI_Mm01_00091409 predicted 246
6 SASI_Mm01_00091410 predicted 490
7 SASI_Mm01_00091411 predicted 957
8 SASI_Mm01_00091412 predicted 688
9 SASI_Mm01_00091413 predicted 483
10 SASI_Mm02_00334689 predicted 798
11 SASI_Mm01_00091406 predicted 389
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080530
SNX29 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 29
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000431058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080530.2-830s21c1
Sequence:CCGGAGACCAGAGTTTGTCGGATTTCTCGAGAAATCCGACAAACTCTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080530.2-1505s21c1
Sequence:CCGGAGTCTTCGAGCCGCATGATACCTCGAGGTATCATGCGGCTCGAAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220004    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001080530.2-4718s1c1
Sequence:CCGGTAGGGAGCTGCTGGCTATAAACTCGAGTTTATAGCCAGCAGCTCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080530
SNX29 MISSION shRNA shRNA Plasmid DNA
sorting nexin 29
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000431058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080530.2-830s21c1
Sequence:CCGGAGACCAGAGTTTGTCGGATTTCTCGAGAAATCCGACAAACTCTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080530.2-1505s21c1
Sequence:CCGGAGTCTTCGAGCCGCATGATACCTCGAGGTATCATGCGGCTCGAAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220004    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001080530.2-4718s1c1
Sequence:CCGGTAGGGAGCTGCTGGCTATAAACTCGAGTTTATAGCCAGCAGCTCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080530
SNX29 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 29
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000431058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080530.2-830s21c1
Sequence:CCGGAGACCAGAGTTTGTCGGATTTCTCGAGAAATCCGACAAACTCTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414236    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080530.2-1505s21c1
Sequence:CCGGAGTCTTCGAGCCGCATGATACCTCGAGGTATCATGCGGCTCGAAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220004    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001080530.2-4718s1c1
Sequence:CCGGTAGGGAGCTGCTGGCTATAAACTCGAGTTTATAGCCAGCAGCTCCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028964
SNX29 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 29
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028964.1-452s1c1
Sequence:CCGGGCCATGATGAACAGAAAGGATCTCGAGATCCTTTCTGTTCATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028964.1-933s1c1
Sequence:CCGGCTGGAGATTTGAGCCAAACATCTCGAGATGTTTGGCTCAAATCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028964.1-932s1c1
Sequence:CCGGCCTGGAGATTTGAGCCAAACACTCGAGTGTTTGGCTCAAATCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028964.1-1055s1c1
Sequence:CCGGCATGTGTATCAGGTCTACATTCTCGAGAATGTAGACCTGATACACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028964.1-1054s1c1
Sequence:CCGGCCATGTGTATCAGGTCTACATCTCGAGATGTAGACCTGATACACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028964
SNX29 MISSION shRNA shRNA Plasmid DNA
sorting nexin 29
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028964.1-452s1c1
Sequence:CCGGGCCATGATGAACAGAAAGGATCTCGAGATCCTTTCTGTTCATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028964.1-933s1c1
Sequence:CCGGCTGGAGATTTGAGCCAAACATCTCGAGATGTTTGGCTCAAATCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028964.1-932s1c1
Sequence:CCGGCCTGGAGATTTGAGCCAAACACTCGAGTGTTTGGCTCAAATCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028964.1-1055s1c1
Sequence:CCGGCATGTGTATCAGGTCTACATTCTCGAGAATGTAGACCTGATACACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028964.1-1054s1c1
Sequence:CCGGCCATGTGTATCAGGTCTACATCTCGAGATGTAGACCTGATACACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028964
SNX29 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 29
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028964.1-452s1c1
Sequence:CCGGGCCATGATGAACAGAAAGGATCTCGAGATCCTTTCTGTTCATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028964.1-933s1c1
Sequence:CCGGCTGGAGATTTGAGCCAAACATCTCGAGATGTTTGGCTCAAATCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028964.1-932s1c1
Sequence:CCGGCCTGGAGATTTGAGCCAAACACTCGAGTGTTTGGCTCAAATCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028964.1-1055s1c1
Sequence:CCGGCATGTGTATCAGGTCTACATTCTCGAGAATGTAGACCTGATACACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028964.1-1054s1c1
Sequence:CCGGCCATGTGTATCAGGTCTACATCTCGAGATGTAGACCTGATACACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001009607
SNX29 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 29
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009607.1-242s1c1
Sequence:CCGGGCAGCGTCATGAACAAAGTCACTCGAGTGACTTTGTTCATGACGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009607.1-216s1c1
Sequence:CCGGGAGAAAGCAGCTCCAGAATTACTCGAGTAATTCTGGAGCTGCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009607.1-249s1c1
Sequence:CCGGCATGAACAAAGTCATCCAGATCTCGAGATCTGGATGACTTTGTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009607.1-350s1c1
Sequence:CCGGGAATGTACGGATTGTTTCATTCTCGAGAATGAAACAATCCGTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009607.1-348s1c1
Sequence:CCGGCGGAATGTACGGATTGTTTCACTCGAGTGAAACAATCCGTACATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009607.1-243s1c1
Sequence:CCGGCAGCGTCATGAACAAAGTCATCTCGAGATGACTTTGTTCATGACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009607.1-333s1c1
Sequence:CCGGGATGGGATTACAGGTCGGAATCTCGAGATTCCGACCTGTAATCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001009607
SNX29 MISSION shRNA shRNA Plasmid DNA
sorting nexin 29
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009607.1-242s1c1
Sequence:CCGGGCAGCGTCATGAACAAAGTCACTCGAGTGACTTTGTTCATGACGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009607.1-216s1c1
Sequence:CCGGGAGAAAGCAGCTCCAGAATTACTCGAGTAATTCTGGAGCTGCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009607.1-249s1c1
Sequence:CCGGCATGAACAAAGTCATCCAGATCTCGAGATCTGGATGACTTTGTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009607.1-350s1c1
Sequence:CCGGGAATGTACGGATTGTTTCATTCTCGAGAATGAAACAATCCGTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009607.1-348s1c1
Sequence:CCGGCGGAATGTACGGATTGTTTCACTCGAGTGAAACAATCCGTACATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009607.1-243s1c1
Sequence:CCGGCAGCGTCATGAACAAAGTCATCTCGAGATGACTTTGTTCATGACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009607.1-333s1c1
Sequence:CCGGGATGGGATTACAGGTCGGAATCTCGAGATTCCGACCTGTAATCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001009607
SNX29 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 29
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009607.1-242s1c1
Sequence:CCGGGCAGCGTCATGAACAAAGTCACTCGAGTGACTTTGTTCATGACGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161256    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009607.1-216s1c1
Sequence:CCGGGAGAAAGCAGCTCCAGAATTACTCGAGTAATTCTGGAGCTGCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160553    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009607.1-249s1c1
Sequence:CCGGCATGAACAAAGTCATCCAGATCTCGAGATCTGGATGACTTTGTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009607.1-350s1c1
Sequence:CCGGGAATGTACGGATTGTTTCATTCTCGAGAATGAAACAATCCGTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009607.1-348s1c1
Sequence:CCGGCGGAATGTACGGATTGTTTCACTCGAGTGAAACAATCCGTACATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009607.1-243s1c1
Sequence:CCGGCAGCGTCATGAACAAAGTCATCTCGAGATGACTTTGTTCATGACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001009607.1-333s1c1
Sequence:CCGGGATGGGATTACAGGTCGGAATCTCGAGATTCCGACCTGTAATCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks