EMAIL THIS PAGE TO A FRIEND

SNX2

sorting nexin 2

Synonyms: TRG-9
Gene ID:
Human(6643) Summary: This gene belongs to the sorting nexin family whose members contain the phosphoinositide-binding phox (PX) domain. The encoded protein is a component of the retromer complex which plays a role in protein sorting in the endocytic pathway. This protein may form oligomeric complexes with other family members. Alternate splicing results in multiple transcript variants of this gene. Pseudogenes associated with this gene are located on chromosomes 1 and 7. [provided by RefSeq, May 2013]
Mouse(67804) sorting nexin 2
Rat(291464) sorting nexin 2
Zebrafish(568737) sorting nexin 2
dog(474657) sorting nexin 2
Horse(100073099) sorting nexin 2
domestic cat(101083737) sorting nexin 2
chicken(426797) sorting nexin 2
cow(509769) sorting nexin 2
sheep(101111279) sorting nexin 2
naked mole-rat(101721735) sorting nexin 2
101 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026386 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026386 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026386 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003100 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003100 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003100 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003100 Rosetta Predictions human pricing
NM_001106135 Rosetta Predictions rat pricing
NM_026386 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003100 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184780 predicted 1290
2 SASI_Hs01_00184781 predicted 1002
3 SASI_Hs01_00184783 predicted 1225
4 SASI_Hs01_00184785 predicted 274
5 SASI_Hs01_00184786 predicted 1510
6 SASI_Hs01_00184787 predicted 525
7 SASI_Hs01_00184788 predicted 886
8 SASI_Hs02_00335059 predicted 1129
9 SASI_Hs01_00184789 predicted 681
10 SASI_Hs02_00335060 predicted 392
11 SASI_Hs01_00184782 predicted 384
12 SASI_Hs01_00184784 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106135 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215968 predicted 1246
2 SASI_Rn02_00215969 predicted 1509
3 SASI_Rn02_00215970 predicted 1284
4 SASI_Rn02_00215971 predicted 1092
5 SASI_Rn02_00215972 predicted 336
6 SASI_Rn02_00215973 predicted 1291
7 SASI_Rn02_00215974 predicted 869
8 SASI_Rn02_00215975 predicted 287
9 SASI_Rn02_00215976 predicted 1493
10 SASI_Rn02_00215977 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026386 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023949 predicted 1238
2 SASI_Mm01_00023950 predicted 1611
3 SASI_Mm01_00023951 predicted 1267
4 SASI_Mm01_00023953 predicted 355
5 SASI_Mm01_00023954 predicted 845
6 SASI_Mm01_00023955 predicted 814
7 SASI_Mm01_00023956 predicted 1469
8 SASI_Mm02_00330139 predicted 1183
9 SASI_Mm01_00023957 predicted 649
10 SASI_Mm01_00023958 predicted 407
11 SASI_Mm01_00023952 predicted 980
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026386
VALIDATED
SNX2 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026386.1-1273s1c1
Sequence:CCGGGCTCAAATTACCTTGCTCAAACTCGAGTTTGAGCAAGGTAATTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093214    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026386.1-1627s1c1
Sequence:CCGGCCATCTAAATAAACCACTCTACTCGAGTAGAGTGGTTTATTTAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026386.1-175s1c1
Sequence:CCGGGCAAACTCTAATGGCTCCAAACTCGAGTTTGGAGCCATTAGAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026386.1-586s1c1
Sequence:CCGGCATAGCAAATTAGCAAGCAAACTCGAGTTTGCTTGCTAATTTGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026386.1-332s1c1
Sequence:CCGGCCACACTCATTGCTCCTAGAACTCGAGTTCTAGGAGCAATGAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026386.1-1627s21c1
Sequence:CCGGCCATCTAAATAAACCACTCTACTCGAGTAGAGTGGTTTATTTAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026386.1-483s21c1
Sequence:CCGGGAATGCTTACATGGCATATAGCTCGAGCTATATGCCATGTAAGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026386.1-1273s21c1
Sequence:CCGGGCTCAAATTACCTTGCTCAAACTCGAGTTTGAGCAAGGTAATTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026386.1-332s21c1
Sequence:CCGGCCACACTCATTGCTCCTAGAACTCGAGTTCTAGGAGCAATGAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026386.1-175s21c1
Sequence:CCGGGCAAACTCTAATGGCTCCAAACTCGAGTTTGGAGCCATTAGAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026386
VALIDATED
SNX2 MISSION shRNA shRNA Plasmid DNA
sorting nexin 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026386.1-1273s1c1
Sequence:CCGGGCTCAAATTACCTTGCTCAAACTCGAGTTTGAGCAAGGTAATTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093214    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026386.1-1627s1c1
Sequence:CCGGCCATCTAAATAAACCACTCTACTCGAGTAGAGTGGTTTATTTAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026386.1-175s1c1
Sequence:CCGGGCAAACTCTAATGGCTCCAAACTCGAGTTTGGAGCCATTAGAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026386.1-586s1c1
Sequence:CCGGCATAGCAAATTAGCAAGCAAACTCGAGTTTGCTTGCTAATTTGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026386.1-332s1c1
Sequence:CCGGCCACACTCATTGCTCCTAGAACTCGAGTTCTAGGAGCAATGAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026386.1-1627s21c1
Sequence:CCGGCCATCTAAATAAACCACTCTACTCGAGTAGAGTGGTTTATTTAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026386.1-483s21c1
Sequence:CCGGGAATGCTTACATGGCATATAGCTCGAGCTATATGCCATGTAAGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026386.1-1273s21c1
Sequence:CCGGGCTCAAATTACCTTGCTCAAACTCGAGTTTGAGCAAGGTAATTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026386.1-332s21c1
Sequence:CCGGCCACACTCATTGCTCCTAGAACTCGAGTTCTAGGAGCAATGAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026386.1-175s21c1
Sequence:CCGGGCAAACTCTAATGGCTCCAAACTCGAGTTTGGAGCCATTAGAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026386
VALIDATED
SNX2 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026386.1-1273s1c1
Sequence:CCGGGCTCAAATTACCTTGCTCAAACTCGAGTTTGAGCAAGGTAATTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093214    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026386.1-1627s1c1
Sequence:CCGGCCATCTAAATAAACCACTCTACTCGAGTAGAGTGGTTTATTTAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026386.1-175s1c1
Sequence:CCGGGCAAACTCTAATGGCTCCAAACTCGAGTTTGGAGCCATTAGAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026386.1-586s1c1
Sequence:CCGGCATAGCAAATTAGCAAGCAAACTCGAGTTTGCTTGCTAATTTGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026386.1-332s1c1
Sequence:CCGGCCACACTCATTGCTCCTAGAACTCGAGTTCTAGGAGCAATGAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026386.1-1627s21c1
Sequence:CCGGCCATCTAAATAAACCACTCTACTCGAGTAGAGTGGTTTATTTAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026386.1-483s21c1
Sequence:CCGGGAATGCTTACATGGCATATAGCTCGAGCTATATGCCATGTAAGCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026386.1-1273s21c1
Sequence:CCGGGCTCAAATTACCTTGCTCAAACTCGAGTTTGAGCAAGGTAATTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026386.1-332s21c1
Sequence:CCGGCCACACTCATTGCTCCTAGAACTCGAGTTCTAGGAGCAATGAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026386.1-175s21c1
Sequence:CCGGGCAAACTCTAATGGCTCCAAACTCGAGTTTGGAGCCATTAGAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003100
VALIDATED
SNX2 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003100.2-230s1c1
Sequence:CCGGCCCACAGAAGTTGTATTAGATCTCGAGATCTAATACAACTTCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003100.2-1250s1c1
Sequence:CCGGGCTGCAGTGAAAGGTGTGTTTCTCGAGAAACACACCTTTCACTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_003100.2-1307s1c1
Sequence:CCGGGCTCAAATTACTTTGCTCAAACTCGAGTTTGAGCAAAGTAATTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003100.2-150s1c1
Sequence:CCGGCCCTAGAGTCAAGTCCATCATCTCGAGATGATGGACTTGACTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003100.2-619s1c1
Sequence:CCGGGCACAGCAAATTAGCAAGCAACTCGAGTTGCTTGCTAATTTGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003100.2-1610s21c1
Sequence:GTACCGGCAATAAGATTGTTGCCGTTAACTCGAGTTAACGGCAACAATCTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003100.2-1820s21c1
Sequence:GTACCGGGTGGACTGTGGCATGACATTCCTCGAGGAATGTCATGCCACAGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003100.2-619s21c1
Sequence:CCGGGCACAGCAAATTAGCAAGCAACTCGAGTTGCTTGCTAATTTGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003100.2-230s21c1
Sequence:CCGGCCCACAGAAGTTGTATTAGATCTCGAGATCTAATACAACTTCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003100.2-150s21c1
Sequence:CCGGCCCTAGAGTCAAGTCCATCATCTCGAGATGATGGACTTGACTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003100.2-1250s21c1
Sequence:CCGGGCTGCAGTGAAAGGTGTGTTTCTCGAGAAACACACCTTTCACTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003100.2-1089s21c1
Sequence:GTACCGGGTGCTGCCATGTTAGGTAATTCTCGAGAATTACCTAACATGGCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003100
VALIDATED
SNX2 MISSION shRNA shRNA Plasmid DNA
sorting nexin 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003100.2-230s1c1
Sequence:CCGGCCCACAGAAGTTGTATTAGATCTCGAGATCTAATACAACTTCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003100.2-1250s1c1
Sequence:CCGGGCTGCAGTGAAAGGTGTGTTTCTCGAGAAACACACCTTTCACTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_003100.2-1307s1c1
Sequence:CCGGGCTCAAATTACTTTGCTCAAACTCGAGTTTGAGCAAAGTAATTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003100.2-150s1c1
Sequence:CCGGCCCTAGAGTCAAGTCCATCATCTCGAGATGATGGACTTGACTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003100.2-619s1c1
Sequence:CCGGGCACAGCAAATTAGCAAGCAACTCGAGTTGCTTGCTAATTTGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003100.2-1610s21c1
Sequence:GTACCGGCAATAAGATTGTTGCCGTTAACTCGAGTTAACGGCAACAATCTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003100.2-1820s21c1
Sequence:GTACCGGGTGGACTGTGGCATGACATTCCTCGAGGAATGTCATGCCACAGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003100.2-619s21c1
Sequence:CCGGGCACAGCAAATTAGCAAGCAACTCGAGTTGCTTGCTAATTTGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003100.2-230s21c1
Sequence:CCGGCCCACAGAAGTTGTATTAGATCTCGAGATCTAATACAACTTCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003100.2-150s21c1
Sequence:CCGGCCCTAGAGTCAAGTCCATCATCTCGAGATGATGGACTTGACTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003100.2-1250s21c1
Sequence:CCGGGCTGCAGTGAAAGGTGTGTTTCTCGAGAAACACACCTTTCACTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003100.2-1089s21c1
Sequence:GTACCGGGTGCTGCCATGTTAGGTAATTCTCGAGAATTACCTAACATGGCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003100
VALIDATED
SNX2 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003100.2-230s1c1
Sequence:CCGGCCCACAGAAGTTGTATTAGATCTCGAGATCTAATACAACTTCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003100.2-1250s1c1
Sequence:CCGGGCTGCAGTGAAAGGTGTGTTTCTCGAGAAACACACCTTTCACTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_003100.2-1307s1c1
Sequence:CCGGGCTCAAATTACTTTGCTCAAACTCGAGTTTGAGCAAAGTAATTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003100.2-150s1c1
Sequence:CCGGCCCTAGAGTCAAGTCCATCATCTCGAGATGATGGACTTGACTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003100.2-619s1c1
Sequence:CCGGGCACAGCAAATTAGCAAGCAACTCGAGTTGCTTGCTAATTTGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003100.2-1610s21c1
Sequence:GTACCGGCAATAAGATTGTTGCCGTTAACTCGAGTTAACGGCAACAATCTTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381982    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003100.2-1820s21c1
Sequence:GTACCGGGTGGACTGTGGCATGACATTCCTCGAGGAATGTCATGCCACAGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003100.2-619s21c1
Sequence:CCGGGCACAGCAAATTAGCAAGCAACTCGAGTTGCTTGCTAATTTGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003100.2-230s21c1
Sequence:CCGGCCCACAGAAGTTGTATTAGATCTCGAGATCTAATACAACTTCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003100.2-150s21c1
Sequence:CCGGCCCTAGAGTCAAGTCCATCATCTCGAGATGATGGACTTGACTCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003100.2-1250s21c1
Sequence:CCGGGCTGCAGTGAAAGGTGTGTTTCTCGAGAAACACACCTTTCACTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003100.2-1089s21c1
Sequence:GTACCGGGTGCTGCCATGTTAGGTAATTCTCGAGAATTACCTAACATGGCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks