EMAIL THIS PAGE TO A FRIEND

SNX30

sorting nexin family member 30

Synonyms: ATG24A
UniProtKB ID: Q5VWJ9
Gene ID:
Mouse(209131) sorting nexin family member 30
Rat(298033) sorting nexin family member 30
cow(517400) sorting nexin family member 30
sheep(101120898) sorting nexin family member 30
Domestic Rabbit(100350458) sorting nexin family member 30
naked mole-rat(101712258) sorting nexin family member 30
Zebrafish(550496) sorting nexin family member 30
domestic cat(101080584) sorting nexin family member 30
Horse(100056926) sorting nexin family member 30
chicken(427330) sorting nexin family member 30
dog(481672) sorting nexin family member 30
43 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172468 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172468 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172468 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001012994 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012994 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012994 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012994 Rosetta Predictions human pricing
NM_001106651 Rosetta Predictions rat pricing
NM_172468 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012994 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306315 predicted 408
2 SASI_Hs02_00306316 predicted 972
3 SASI_Hs02_00306317 predicted 507
4 SASI_Hs02_00306318 predicted 573
5 SASI_Hs02_00306319 predicted 902
6 SASI_Hs02_00306320 predicted 411
7 SASI_Hs02_00306321 predicted 1072
8 SASI_Hs02_00306322 predicted 1512
9 SASI_Hs02_00306323 predicted 755
10 SASI_Hs02_00306324 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106651 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221048 predicted 829
2 SASI_Rn02_00221049 predicted 993
3 SASI_Rn02_00221050 predicted 576
4 SASI_Rn02_00221051 predicted 1222
5 SASI_Rn02_00221052 predicted 1197
6 SASI_Rn02_00221053 predicted 411
7 SASI_Rn02_00221054 predicted 469
8 SASI_Rn02_00221055 predicted 1053
9 SASI_Rn02_00221056 predicted 508
10 SASI_Rn02_00221057 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172468 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344006 predicted 677
2 SASI_Mm02_00344007 predicted 649
3 SASI_Mm02_00344008 predicted 1763
4 SASI_Mm02_00344009 predicted 1383
5 SASI_Mm02_00344010 predicted 559
6 SASI_Mm02_00344011 predicted 1025
7 SASI_Mm02_00344012 predicted 675
8 SASI_Mm02_00344013 predicted 1397
9 SASI_Mm02_00344014 predicted 668
10 SASI_Mm02_00344015 predicted 685
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172468
VALIDATED
SNX30 MISSION shRNA Bacterial Glycerol Stock
sorting nexin family member 30
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172468.2-1681s21c1
Sequence:CCGGATGGCGTGGGAGTCCATTATTCTCGAGAATAATGGACTCCCACGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172468.2-1359s21c1
Sequence:CCGGAGAGCTGACAGATGACATAACCTCGAGGTTATGTCATCTGTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288316    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172468.2-1955s21c1
Sequence:CCGGCCTCTTAAATGGAACACTAAACTCGAGTTTAGTGTTCCATTTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172468.2-1398s21c1
Sequence:CCGGGCTCAGGGAATACGTTCTGTACTCGAGTACAGAACGTATTCCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172468.2-782s21c1
Sequence:CCGGAGTTTGACTTGCCAGAATATTCTCGAGAATATTCTGGCAAGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172468.1-1757s1c1
Sequence:CCGGCCTCTTAAATGGAACACTAAACTCGAGTTTAGTGTTCCATTTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172468.1-1447s1c1
Sequence:CCGGGCTGACAAGAATATCCAGTATCTCGAGATACTGGATATTCTTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172468.1-1014s1c1
Sequence:CCGGGCGGATCATCAAGGAAGAAATCTCGAGATTTCTTCCTTGATGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172468.1-369s1c1
Sequence:CCGGCGGTGACAAGGATCTCATCTTCTCGAGAAGATGAGATCCTTGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172468.1-1200s1c1
Sequence:CCGGGCTCAGGGAATACGTTCTGTACTCGAGTACAGAACGTATTCCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172468
VALIDATED
SNX30 MISSION shRNA shRNA Plasmid DNA
sorting nexin family member 30
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172468.2-1681s21c1
Sequence:CCGGATGGCGTGGGAGTCCATTATTCTCGAGAATAATGGACTCCCACGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172468.2-1359s21c1
Sequence:CCGGAGAGCTGACAGATGACATAACCTCGAGGTTATGTCATCTGTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288316    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172468.2-1955s21c1
Sequence:CCGGCCTCTTAAATGGAACACTAAACTCGAGTTTAGTGTTCCATTTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172468.2-1398s21c1
Sequence:CCGGGCTCAGGGAATACGTTCTGTACTCGAGTACAGAACGTATTCCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172468.2-782s21c1
Sequence:CCGGAGTTTGACTTGCCAGAATATTCTCGAGAATATTCTGGCAAGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172468.1-1757s1c1
Sequence:CCGGCCTCTTAAATGGAACACTAAACTCGAGTTTAGTGTTCCATTTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172468.1-1447s1c1
Sequence:CCGGGCTGACAAGAATATCCAGTATCTCGAGATACTGGATATTCTTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172468.1-1014s1c1
Sequence:CCGGGCGGATCATCAAGGAAGAAATCTCGAGATTTCTTCCTTGATGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172468.1-369s1c1
Sequence:CCGGCGGTGACAAGGATCTCATCTTCTCGAGAAGATGAGATCCTTGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172468.1-1200s1c1
Sequence:CCGGGCTCAGGGAATACGTTCTGTACTCGAGTACAGAACGTATTCCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172468
VALIDATED
SNX30 MISSION shRNA Lentiviral Transduction Particles
sorting nexin family member 30
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172468.2-1681s21c1
Sequence:CCGGATGGCGTGGGAGTCCATTATTCTCGAGAATAATGGACTCCCACGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172468.2-1359s21c1
Sequence:CCGGAGAGCTGACAGATGACATAACCTCGAGGTTATGTCATCTGTCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288316    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172468.2-1955s21c1
Sequence:CCGGCCTCTTAAATGGAACACTAAACTCGAGTTTAGTGTTCCATTTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172468.2-1398s21c1
Sequence:CCGGGCTCAGGGAATACGTTCTGTACTCGAGTACAGAACGTATTCCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172468.2-782s21c1
Sequence:CCGGAGTTTGACTTGCCAGAATATTCTCGAGAATATTCTGGCAAGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172468.1-1757s1c1
Sequence:CCGGCCTCTTAAATGGAACACTAAACTCGAGTTTAGTGTTCCATTTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172468.1-1447s1c1
Sequence:CCGGGCTGACAAGAATATCCAGTATCTCGAGATACTGGATATTCTTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172468.1-1014s1c1
Sequence:CCGGGCGGATCATCAAGGAAGAAATCTCGAGATTTCTTCCTTGATGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172468.1-369s1c1
Sequence:CCGGCGGTGACAAGGATCTCATCTTCTCGAGAAGATGAGATCCTTGTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172468.1-1200s1c1
Sequence:CCGGGCTCAGGGAATACGTTCTGTACTCGAGTACAGAACGTATTCCCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012994
VALIDATED
SNX30 MISSION shRNA Bacterial Glycerol Stock
sorting nexin family member 30
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012994.1-294s21c1
Sequence:CCGGTCGGTGACAAGGATCTCATTTCTCGAGAAATGAGATCCTTGTCACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012994.1-410s21c1
Sequence:CCGGACTAGAGATCTCTTCGTTATACTCGAGTATAACGAAGAGATCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012994.1-884s21c1
Sequence:CCGGGGTGACTACTTAGATACATTTCTCGAGAAATGTATCTAAGTAGTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012994.1-1409s21c1
Sequence:CCGGATGGCGTGGGAGTCGATTATTCTCGAGAATAATCGACTCCCACGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245752    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012994.1-2505s21c1
Sequence:CCGGGTTATGATACAGTCGAAATTTCTCGAGAAATTTCGACTGTATCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012994
VALIDATED
SNX30 MISSION shRNA shRNA Plasmid DNA
sorting nexin family member 30
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012994.1-294s21c1
Sequence:CCGGTCGGTGACAAGGATCTCATTTCTCGAGAAATGAGATCCTTGTCACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012994.1-410s21c1
Sequence:CCGGACTAGAGATCTCTTCGTTATACTCGAGTATAACGAAGAGATCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012994.1-884s21c1
Sequence:CCGGGGTGACTACTTAGATACATTTCTCGAGAAATGTATCTAAGTAGTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012994.1-1409s21c1
Sequence:CCGGATGGCGTGGGAGTCGATTATTCTCGAGAATAATCGACTCCCACGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245752    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012994.1-2505s21c1
Sequence:CCGGGTTATGATACAGTCGAAATTTCTCGAGAAATTTCGACTGTATCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012994
VALIDATED
SNX30 MISSION shRNA Lentiviral Transduction Particles
sorting nexin family member 30
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012994.1-294s21c1
Sequence:CCGGTCGGTGACAAGGATCTCATTTCTCGAGAAATGAGATCCTTGTCACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012994.1-410s21c1
Sequence:CCGGACTAGAGATCTCTTCGTTATACTCGAGTATAACGAAGAGATCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012994.1-884s21c1
Sequence:CCGGGGTGACTACTTAGATACATTTCTCGAGAAATGTATCTAAGTAGTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012994.1-1409s21c1
Sequence:CCGGATGGCGTGGGAGTCGATTATTCTCGAGAATAATCGACTCCCACGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245752    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001012994.1-2505s21c1
Sequence:CCGGGTTATGATACAGTCGAAATTTCTCGAGAAATTTCGACTGTATCATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks