EMAIL THIS PAGE TO A FRIEND

SNX31

sorting nexin 31

UniProtKB ID: Q8N9S9, C9J6L9, Q8N0U9
Gene ID:
Mouse(66696) sorting nexin 31
dog(607160) sorting nexin 31
Horse(100061389) sorting nexin 31
domestic cat(101097870) sorting nexin 31
naked mole-rat(101720424) sorting nexin 31
cow(781881) sorting nexin 31
sheep(101103245) sorting nexin 31
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025712 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025712 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025712 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152628 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152628 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152628 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138761 MISSION® esiRNA esiRNA human SNX31 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152628 Rosetta Predictions human pricing
NM_025712 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152628 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366492 predicted 1284
2 SASI_Hs01_00052119 predicted 1318
3 SASI_Hs01_00052120 predicted 1097
4 SASI_Hs01_00052121 predicted 1171
5 SASI_Hs01_00052122 predicted 1029
6 SASI_Hs01_00052123 predicted 703
7 SASI_Hs01_00052124 predicted 563
8 SASI_Hs01_00052125 predicted 1161
9 SASI_Hs01_00052126 predicted 525
10 SASI_Hs01_00052127 predicted 1204
11 SASI_Hs01_00052118 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025712 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123473 predicted 1443
2 SASI_Mm01_00123474 predicted 1084
3 SASI_Mm01_00123475 predicted 402
4 SASI_Mm01_00123476 predicted 594
5 SASI_Mm01_00123477 predicted 1126
6 SASI_Mm01_00123478 predicted 793
7 SASI_Mm02_00328896 predicted 982
8 SASI_Mm01_00123480 predicted 1074
9 SASI_Mm01_00123481 predicted 1003
10 SASI_Mm02_00328897 predicted 325
11 SASI_Mm01_00123472 predicted 1278
12 SASI_Mm01_00123479 predicted 241
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025712
SNX31 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 31
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025712.2-953s1c1
Sequence:CCGGGCTGCTGTATAACTTTGCCTACTCGAGTAGGCAAAGTTATACAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025712.2-1121s1c1
Sequence:CCGGGCCAGCAGTGGTTTGTTATTTCTCGAGAAATAACAAACCACTGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025712.2-1328s1c1
Sequence:CCGGGATCCGAAGGTGACTATGTTTCTCGAGAAACATAGTCACCTTCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025712.2-443s1c1
Sequence:CCGGGCATTAAAGTAGAAGGTCTAACTCGAGTTAGACCTTCTACTTTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176534    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025712.2-1725s1c1
Sequence:CCGGCCAAAGTAGATTCACCAGATTCTCGAGAATCTGGTGAATCTACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025712.2-381s1c1
Sequence:CCGGGCACACATTGAATATCACCATCTCGAGATGGTGATATTCAATGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025712
SNX31 MISSION shRNA shRNA Plasmid DNA
sorting nexin 31
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025712.2-953s1c1
Sequence:CCGGGCTGCTGTATAACTTTGCCTACTCGAGTAGGCAAAGTTATACAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025712.2-1121s1c1
Sequence:CCGGGCCAGCAGTGGTTTGTTATTTCTCGAGAAATAACAAACCACTGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025712.2-1328s1c1
Sequence:CCGGGATCCGAAGGTGACTATGTTTCTCGAGAAACATAGTCACCTTCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025712.2-443s1c1
Sequence:CCGGGCATTAAAGTAGAAGGTCTAACTCGAGTTAGACCTTCTACTTTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176534    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025712.2-1725s1c1
Sequence:CCGGCCAAAGTAGATTCACCAGATTCTCGAGAATCTGGTGAATCTACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025712.2-381s1c1
Sequence:CCGGGCACACATTGAATATCACCATCTCGAGATGGTGATATTCAATGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025712
SNX31 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 31
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025712.2-953s1c1
Sequence:CCGGGCTGCTGTATAACTTTGCCTACTCGAGTAGGCAAAGTTATACAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025712.2-1121s1c1
Sequence:CCGGGCCAGCAGTGGTTTGTTATTTCTCGAGAAATAACAAACCACTGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025712.2-1328s1c1
Sequence:CCGGGATCCGAAGGTGACTATGTTTCTCGAGAAACATAGTCACCTTCGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025712.2-443s1c1
Sequence:CCGGGCATTAAAGTAGAAGGTCTAACTCGAGTTAGACCTTCTACTTTAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176534    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025712.2-1725s1c1
Sequence:CCGGCCAAAGTAGATTCACCAGATTCTCGAGAATCTGGTGAATCTACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025712.2-381s1c1
Sequence:CCGGGCACACATTGAATATCACCATCTCGAGATGGTGATATTCAATGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152628
SNX31 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 31
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152628.2-755s1c1
Sequence:CCGGCGAAAGTGGTATATGGCTCCACTCGAGTGGAGCCATATACCACTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152628.2-418s1c1
Sequence:CCGGCCCAAACGTGTTGAGAAGTGACTCGAGTCACTTCTCAACACGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152628.2-2282s1c1
Sequence:CCGGGCTTCATTTCTCTCATGGTAACTCGAGTTACCATGAGAGAAATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152628.2-1171s1c1
Sequence:CCGGCCAGAACTTAGAGCTCAGATTCTCGAGAATCTGAGCTCTAAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152628.2-830s1c1
Sequence:CCGGCAGGCAATACAGGACATTGAACTCGAGTTCAATGTCCTGTATTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152628.2-689s1c1
Sequence:CCGGGCTGACTTTGAACTCCCTTATCTCGAGATAAGGGAGTTCAAAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152628.2-637s1c1
Sequence:CCGGCTTTCTCATTCGGTTTGGCAACTCGAGTTGCCAAACCGAATGAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152628.2-2037s1c1
Sequence:CCGGCCTCACATAAGTCTGAGCCTACTCGAGTAGGCTCAGACTTATGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152628.2-530s1c1
Sequence:CCGGCAGAGTATTAGAATCGAAATTCTCGAGAATTTCGATTCTAATACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152628.2-1412s1c1
Sequence:CCGGAGCAAGATTAAGATAGCTAAACTCGAGTTTAGCTATCTTAATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152628
SNX31 MISSION shRNA shRNA Plasmid DNA
sorting nexin 31
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152628.2-755s1c1
Sequence:CCGGCGAAAGTGGTATATGGCTCCACTCGAGTGGAGCCATATACCACTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152628.2-418s1c1
Sequence:CCGGCCCAAACGTGTTGAGAAGTGACTCGAGTCACTTCTCAACACGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152628.2-2282s1c1
Sequence:CCGGGCTTCATTTCTCTCATGGTAACTCGAGTTACCATGAGAGAAATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152628.2-1171s1c1
Sequence:CCGGCCAGAACTTAGAGCTCAGATTCTCGAGAATCTGAGCTCTAAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152628.2-830s1c1
Sequence:CCGGCAGGCAATACAGGACATTGAACTCGAGTTCAATGTCCTGTATTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152628.2-689s1c1
Sequence:CCGGGCTGACTTTGAACTCCCTTATCTCGAGATAAGGGAGTTCAAAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152628.2-637s1c1
Sequence:CCGGCTTTCTCATTCGGTTTGGCAACTCGAGTTGCCAAACCGAATGAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152628.2-2037s1c1
Sequence:CCGGCCTCACATAAGTCTGAGCCTACTCGAGTAGGCTCAGACTTATGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152628.2-530s1c1
Sequence:CCGGCAGAGTATTAGAATCGAAATTCTCGAGAATTTCGATTCTAATACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152628.2-1412s1c1
Sequence:CCGGAGCAAGATTAAGATAGCTAAACTCGAGTTTAGCTATCTTAATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152628
SNX31 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 31
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152628.2-755s1c1
Sequence:CCGGCGAAAGTGGTATATGGCTCCACTCGAGTGGAGCCATATACCACTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152628.2-418s1c1
Sequence:CCGGCCCAAACGTGTTGAGAAGTGACTCGAGTCACTTCTCAACACGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152628.2-2282s1c1
Sequence:CCGGGCTTCATTTCTCTCATGGTAACTCGAGTTACCATGAGAGAAATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152628.2-1171s1c1
Sequence:CCGGCCAGAACTTAGAGCTCAGATTCTCGAGAATCTGAGCTCTAAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152628.2-830s1c1
Sequence:CCGGCAGGCAATACAGGACATTGAACTCGAGTTCAATGTCCTGTATTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152628.2-689s1c1
Sequence:CCGGGCTGACTTTGAACTCCCTTATCTCGAGATAAGGGAGTTCAAAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152628.2-637s1c1
Sequence:CCGGCTTTCTCATTCGGTTTGGCAACTCGAGTTGCCAAACCGAATGAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152628.2-2037s1c1
Sequence:CCGGCCTCACATAAGTCTGAGCCTACTCGAGTAGGCTCAGACTTATGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152628.2-530s1c1
Sequence:CCGGCAGAGTATTAGAATCGAAATTCTCGAGAATTTCGATTCTAATACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152628.2-1412s1c1
Sequence:CCGGAGCAAGATTAAGATAGCTAAACTCGAGTTTAGCTATCTTAATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks