EMAIL THIS PAGE TO A FRIEND

SNX32

sorting nexin 32

Synonyms: SNX6B
UniProtKB ID: Q86XE0, Q8IW53, Q96NG4
Gene ID:
Mouse(225861) sorting nexin 32
Rat(361708) sorting nexin 32
cow(789733) sorting nexin 32
sheep(101102945) sorting nexin 32
Horse(100051682) sorting nexin 32
domestic cat(101097348) sorting nexin 32
dog(483726) sorting nexin 32
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152760 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152760 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152760 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001024560 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024560 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024560 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152760 Rosetta Predictions human pricing
XM_001073782 Rosetta Predictions rat pricing
XM_341993 Rosetta Predictions rat pricing
NM_001024560 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152760 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179670 predicted 988
2 SASI_Hs01_00179671 predicted 493
3 SASI_Hs01_00179672 predicted 525
4 SASI_Hs01_00179674 predicted 759
5 SASI_Hs01_00179675 predicted 765
6 SASI_Hs01_00179677 predicted 1189
7 SASI_Hs01_00179678 predicted 837
8 SASI_Hs01_00179679 predicted 811
9 SASI_Hs02_00366696 predicted 1003
10 SASI_Hs02_00366697 predicted 1420
11 SASI_Hs01_00179673 predicted 1301
12 SASI_Hs01_00179676 predicted 907
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073782 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00343914 predicted 1238
2 SASI_Rn02_00343915 predicted 766
3 SASI_Rn02_00343916 predicted 1433
4 SASI_Rn02_00343917 predicted 501
5 SASI_Rn02_00343918 predicted 993
6 SASI_Rn02_00343919 predicted 811
7 SASI_Rn02_00343920 predicted 338
8 SASI_Rn02_00343921 predicted 1084
9 SASI_Rn02_00343922 predicted 1317
10 SASI_Rn02_00343923 predicted 1001
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341993 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393634 predicted 1231
2 SASI_Rn02_00393635 predicted 765
3 SASI_Rn02_00393636 predicted 1431
4 SASI_Rn02_00393637 predicted 497
5 SASI_Rn02_00393638 predicted 995
6 SASI_Rn02_00393639 predicted 805
7 SASI_Rn02_00393640 predicted 338
8 SASI_Rn02_00393641 predicted 1078
9 SASI_Rn02_00393642 predicted 1313
10 SASI_Rn02_00393643 predicted 1003
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024560 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089851 predicted 1419
2 SASI_Mm01_00089852 predicted 263
3 SASI_Mm01_00089853 predicted 1298
4 SASI_Mm01_00089854 predicted 808
5 SASI_Mm01_00089855 predicted 489
6 SASI_Mm01_00089856 predicted 1078
7 SASI_Mm01_00089857 predicted 1304
8 SASI_Mm01_00089858 predicted 1062
9 SASI_Mm01_00089859 predicted 830
10 SASI_Mm01_00089860 predicted 1178
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152760
SNX32 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 32
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152760.2-199s21c1
Sequence:CCGGCTCCTTACAGGTGGAGATTTCCTCGAGGAAATCTCCACCTGTAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152760.2-998s21c1
Sequence:CCGGGACATGCTGAGGTACTACATGCTCGAGCATGTAGTACCTCAGCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152760.2-582s21c1
Sequence:CCGGGTCGAGACCACAACTTCTTTGCTCGAGCAAAGAAGTTGTGGTCTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152760.1-199s1c1
Sequence:CCGGGACAAGGTGAAATTCACTGTTCTCGAGAACAGTGAATTTCACCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152760.1-472s1c1
Sequence:CCGGGCCATCTTTAAGAAGACAGTTCTCGAGAACTGTCTTCTTAAAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152760.1-705s1c1
Sequence:CCGGCTTTGAGCATGAGAGGACCTTCTCGAGAAGGTCCTCTCATGCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152760.1-729s1c1
Sequence:CCGGGTTGGAGTATCACACCCGTATCTCGAGATACGGGTGTGATACTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152760
SNX32 MISSION shRNA shRNA Plasmid DNA
sorting nexin 32
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152760.2-199s21c1
Sequence:CCGGCTCCTTACAGGTGGAGATTTCCTCGAGGAAATCTCCACCTGTAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152760.2-998s21c1
Sequence:CCGGGACATGCTGAGGTACTACATGCTCGAGCATGTAGTACCTCAGCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152760.2-582s21c1
Sequence:CCGGGTCGAGACCACAACTTCTTTGCTCGAGCAAAGAAGTTGTGGTCTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152760.1-199s1c1
Sequence:CCGGGACAAGGTGAAATTCACTGTTCTCGAGAACAGTGAATTTCACCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152760.1-472s1c1
Sequence:CCGGGCCATCTTTAAGAAGACAGTTCTCGAGAACTGTCTTCTTAAAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152760.1-705s1c1
Sequence:CCGGCTTTGAGCATGAGAGGACCTTCTCGAGAAGGTCCTCTCATGCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152760.1-729s1c1
Sequence:CCGGGTTGGAGTATCACACCCGTATCTCGAGATACGGGTGTGATACTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152760
SNX32 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 32
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152760.2-199s21c1
Sequence:CCGGCTCCTTACAGGTGGAGATTTCCTCGAGGAAATCTCCACCTGTAAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152760.2-998s21c1
Sequence:CCGGGACATGCTGAGGTACTACATGCTCGAGCATGTAGTACCTCAGCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152760.2-582s21c1
Sequence:CCGGGTCGAGACCACAACTTCTTTGCTCGAGCAAAGAAGTTGTGGTCTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152760.1-199s1c1
Sequence:CCGGGACAAGGTGAAATTCACTGTTCTCGAGAACAGTGAATTTCACCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152760.1-472s1c1
Sequence:CCGGGCCATCTTTAAGAAGACAGTTCTCGAGAACTGTCTTCTTAAAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152760.1-705s1c1
Sequence:CCGGCTTTGAGCATGAGAGGACCTTCTCGAGAAGGTCCTCTCATGCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152760.1-729s1c1
Sequence:CCGGGTTGGAGTATCACACCCGTATCTCGAGATACGGGTGTGATACTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024560
SNX32 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 32
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000182592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024560.1-634s1c1
Sequence:CCGGGAAGAACAGGAAGGAGGTCTTCTCGAGAAGACCTCCTTCCTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024560.1-495s1c1
Sequence:CCGGCGGAATACTTGGCCATCTTTACTCGAGTAAAGATGGCCAAGTATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182166    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024560.1-1379s1c1
Sequence:CCGGCCCTATAAAGACGCTCTCCTTCTCGAGAAGGAGAGCGTCTTTATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024560.1-883s1c1
Sequence:CCGGCCAGGAAGTCAACCAACTCAACTCGAGTTGAGTTGGTTGACTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024560
SNX32 MISSION shRNA shRNA Plasmid DNA
sorting nexin 32
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000182592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024560.1-634s1c1
Sequence:CCGGGAAGAACAGGAAGGAGGTCTTCTCGAGAAGACCTCCTTCCTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024560.1-495s1c1
Sequence:CCGGCGGAATACTTGGCCATCTTTACTCGAGTAAAGATGGCCAAGTATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182166    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024560.1-1379s1c1
Sequence:CCGGCCCTATAAAGACGCTCTCCTTCTCGAGAAGGAGAGCGTCTTTATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024560.1-883s1c1
Sequence:CCGGCCAGGAAGTCAACCAACTCAACTCGAGTTGAGTTGGTTGACTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024560
SNX32 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 32
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000182592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024560.1-634s1c1
Sequence:CCGGGAAGAACAGGAAGGAGGTCTTCTCGAGAAGACCTCCTTCCTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024560.1-495s1c1
Sequence:CCGGCGGAATACTTGGCCATCTTTACTCGAGTAAAGATGGCCAAGTATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182166    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024560.1-1379s1c1
Sequence:CCGGCCCTATAAAGACGCTCTCCTTCTCGAGAAGGAGAGCGTCTTTATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024560.1-883s1c1
Sequence:CCGGCCAGGAAGTCAACCAACTCAACTCGAGTTGAGTTGGTTGACTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks