EMAIL THIS PAGE TO A FRIEND

SNX33

sorting nexin 33

Synonyms: SH3PX3 SH3PXD3C SNX30
UniProtKB ID: Q8WV41
Gene ID:
Mouse(235406) sorting nexin 33
Rat(315696) sorting nexin 33
Zebrafish(100001421) sorting nexin 33
chicken(415309) sorting nexin 33
Horse(100050956) sorting nexin 33
domestic cat(101097485) sorting nexin 33
dog(487657) sorting nexin 33
naked mole-rat(101719612) sorting nexin 33
Domestic Rabbit(100345125) sorting nexin 33
cow(511561) sorting nexin 33
sheep(101105362) sorting nexin 33
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175483 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175483 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175483 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153271 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153271 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153271 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153271 Rosetta Predictions human pricing
NM_001127488 Rosetta Predictions rat pricing
NM_175483 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153271 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121416 predicted 1288
2 SASI_Hs01_00121417 predicted 810
3 SASI_Hs01_00121418 predicted 1224
4 SASI_Hs01_00121419 predicted 1227
5 SASI_Hs01_00121421 predicted 1781
6 SASI_Hs01_00121422 predicted 1723
7 SASI_Hs01_00121423 predicted 1063
8 SASI_Hs01_00121424 predicted 704
9 SASI_Hs01_00121425 predicted 253
10 SASI_Hs02_00367151 predicted 1537
11 SASI_Hs01_00121420 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127488 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253873 predicted 1800
2 SASI_Rn02_00253874 predicted 1630
3 SASI_Rn02_00253875 predicted 2042
4 SASI_Rn02_00253876 predicted 1318
5 SASI_Rn02_00253877 predicted 1690
6 SASI_Rn02_00253878 predicted 1589
7 SASI_Rn02_00253879 predicted 1521
8 SASI_Rn02_00253880 predicted 2592
9 SASI_Rn02_00253881 predicted 1736
10 SASI_Rn02_00253882 predicted 2613
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175483 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052762 predicted 2930
2 SASI_Mm01_00052763 predicted 2386
3 SASI_Mm02_00346397 predicted 2197
4 SASI_Mm02_00346398 predicted 3344
5 SASI_Mm01_00052764 predicted 2718
6 SASI_Mm02_00346399 predicted 2210
7 SASI_Mm01_00052765 predicted 2268
8 SASI_Mm01_00052766 predicted 2710
9 SASI_Mm01_00052767 predicted 3276
10 SASI_Mm01_00052770 predicted 2365
11 SASI_Mm01_00052768 predicted 1236
12 SASI_Mm01_00052769 predicted 1738
13 SASI_Mm01_00052771 predicted 1631
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175483
SNX33 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 33
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175483.3-2563s1c1
Sequence:CCGGCGGCAGTATCTTGAAGAGTAACTCGAGTTACTCTTCAAGATACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175483.3-1131s1c1
Sequence:CCGGCGGCGCTACAAACACTTTGATCTCGAGATCAAAGTGTTTGTAGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175483.3-1469s1c1
Sequence:CCGGCGTGGATACATTCAAGGCTTTCTCGAGAAAGCCTTGAATGTATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175483.3-529s1c1
Sequence:CCGGGCACCAACCATGTGGACTATTCTCGAGAATAGTCCACATGGTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175483.3-492s1c1
Sequence:CCGGCCTGCTTCTTACGTCGAGATTCTCGAGAATCTCGACGTAAGAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175483
SNX33 MISSION shRNA shRNA Plasmid DNA
sorting nexin 33
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175483.3-2563s1c1
Sequence:CCGGCGGCAGTATCTTGAAGAGTAACTCGAGTTACTCTTCAAGATACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175483.3-1131s1c1
Sequence:CCGGCGGCGCTACAAACACTTTGATCTCGAGATCAAAGTGTTTGTAGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175483.3-1469s1c1
Sequence:CCGGCGTGGATACATTCAAGGCTTTCTCGAGAAAGCCTTGAATGTATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175483.3-529s1c1
Sequence:CCGGGCACCAACCATGTGGACTATTCTCGAGAATAGTCCACATGGTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175483.3-492s1c1
Sequence:CCGGCCTGCTTCTTACGTCGAGATTCTCGAGAATCTCGACGTAAGAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175483
SNX33 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 33
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093384    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175483.3-2563s1c1
Sequence:CCGGCGGCAGTATCTTGAAGAGTAACTCGAGTTACTCTTCAAGATACTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175483.3-1131s1c1
Sequence:CCGGCGGCGCTACAAACACTTTGATCTCGAGATCAAAGTGTTTGTAGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175483.3-1469s1c1
Sequence:CCGGCGTGGATACATTCAAGGCTTTCTCGAGAAAGCCTTGAATGTATCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175483.3-529s1c1
Sequence:CCGGGCACCAACCATGTGGACTATTCTCGAGAATAGTCCACATGGTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175483.3-492s1c1
Sequence:CCGGCCTGCTTCTTACGTCGAGATTCTCGAGAATCTCGACGTAAGAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153271
VALIDATED
SNX33 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 33
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164142    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153271.1-2512s1c1
Sequence:CCGGCCAAGCAAGTTAGGTACGCTTCTCGAGAAGCGTACCTAACTTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153271.1-721s1c1
Sequence:CCGGGCTGAGACATACTCCATTGAACTCGAGTTCAATGGAGTATGTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153271.1-638s1c1
Sequence:CCGGGTAACCTCAACCGTTTCTCATCTCGAGATGAGAAACGGTTGAGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161296    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153271.1-3041s1c1
Sequence:CCGGGCTGTCTCTGACCTATGTTTACTCGAGTAAACATAGGTCAGAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153271.1-1722s1c1
Sequence:CCGGCAAGCACATGATGCAGAACTACTCGAGTAGTTCTGCATCATGTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153271.1-897s1c1
Sequence:CCGGCAAACACTTTGACTGGCTCTACTCGAGTAGAGCCAGTCAAAGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153271.1-1713s1c1
Sequence:CCGGGCTCGACTTCAAGCACATGATCTCGAGATCATGTGCTTGAAGTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153271.1-635s21c1
Sequence:CCGGGCCGTAACCTCAACCGTTTCTCTCGAGAGAAACGGTTGAGGTTACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153271.1-1291s21c1
Sequence:CCGGGCATCAGAGCTGGTGCGTAAACTCGAGTTTACGCACCAGCTCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153271.1-404s21c1
Sequence:CCGGTCTCAAACCAGGGTAGCTTTGCTCGAGCAAAGCTACCCTGGTTTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153271
VALIDATED
SNX33 MISSION shRNA shRNA Plasmid DNA
sorting nexin 33
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164142    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153271.1-2512s1c1
Sequence:CCGGCCAAGCAAGTTAGGTACGCTTCTCGAGAAGCGTACCTAACTTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153271.1-721s1c1
Sequence:CCGGGCTGAGACATACTCCATTGAACTCGAGTTCAATGGAGTATGTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153271.1-638s1c1
Sequence:CCGGGTAACCTCAACCGTTTCTCATCTCGAGATGAGAAACGGTTGAGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161296    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153271.1-3041s1c1
Sequence:CCGGGCTGTCTCTGACCTATGTTTACTCGAGTAAACATAGGTCAGAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153271.1-1722s1c1
Sequence:CCGGCAAGCACATGATGCAGAACTACTCGAGTAGTTCTGCATCATGTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153271.1-897s1c1
Sequence:CCGGCAAACACTTTGACTGGCTCTACTCGAGTAGAGCCAGTCAAAGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153271.1-1713s1c1
Sequence:CCGGGCTCGACTTCAAGCACATGATCTCGAGATCATGTGCTTGAAGTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153271.1-635s21c1
Sequence:CCGGGCCGTAACCTCAACCGTTTCTCTCGAGAGAAACGGTTGAGGTTACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153271.1-1291s21c1
Sequence:CCGGGCATCAGAGCTGGTGCGTAAACTCGAGTTTACGCACCAGCTCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153271.1-404s21c1
Sequence:CCGGTCTCAAACCAGGGTAGCTTTGCTCGAGCAAAGCTACCCTGGTTTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153271
VALIDATED
SNX33 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 33
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164142    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153271.1-2512s1c1
Sequence:CCGGCCAAGCAAGTTAGGTACGCTTCTCGAGAAGCGTACCTAACTTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153271.1-721s1c1
Sequence:CCGGGCTGAGACATACTCCATTGAACTCGAGTTCAATGGAGTATGTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153271.1-638s1c1
Sequence:CCGGGTAACCTCAACCGTTTCTCATCTCGAGATGAGAAACGGTTGAGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161296    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153271.1-3041s1c1
Sequence:CCGGGCTGTCTCTGACCTATGTTTACTCGAGTAAACATAGGTCAGAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_153271.1-1722s1c1
Sequence:CCGGCAAGCACATGATGCAGAACTACTCGAGTAGTTCTGCATCATGTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153271.1-897s1c1
Sequence:CCGGCAAACACTTTGACTGGCTCTACTCGAGTAGAGCCAGTCAAAGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163158    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153271.1-1713s1c1
Sequence:CCGGGCTCGACTTCAAGCACATGATCTCGAGATCATGTGCTTGAAGTCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153271.1-635s21c1
Sequence:CCGGGCCGTAACCTCAACCGTTTCTCTCGAGAGAAACGGTTGAGGTTACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153271.1-1291s21c1
Sequence:CCGGGCATCAGAGCTGGTGCGTAAACTCGAGTTTACGCACCAGCTCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153271.1-404s21c1
Sequence:CCGGTCTCAAACCAGGGTAGCTTTGCTCGAGCAAAGCTACCCTGGTTTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks