EMAIL THIS PAGE TO A FRIEND

SNX3

sorting nexin 3

Synonyms: Grd19 MCOPS8 SDP3
Gene ID:
Human(8724) Summary: This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region, like most family members. This protein interacts with phosphatidylinositol-3-phosphate, and is involved in protein trafficking. [provided by RefSeq, Jul 2008]
Mouse(54198) sorting nexin 3
Rat(684097) sorting nexin 3
fruit fly(41551) Sorting nexin 3
domestic cat(101094420) sorting nexin 3
dog(613007) sorting nexin 3
chicken(421772) sorting nexin 3
Zebrafish(563511) sorting nexin 3
naked mole-rat(101700325) sorting nexin 3
Domestic Rabbit(100328699) sorting nexin 3
cow(528265) sorting nexin 3
sheep(101117083) sorting nexin 3
133 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003795 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003795 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003795 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_017472 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017472 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017472 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003795 Rosetta Predictions human pricing
NM_152827 Rosetta Predictions human pricing
NM_152828 Rosetta Predictions human pricing
NM_001044283 Rosetta Predictions rat pricing
NM_017472 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003795 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234141 predicted 852
2 SASI_Hs02_00336307 predicted 847
3 SASI_Hs02_00336308 predicted 659
4 SASI_Hs02_00336309 predicted 1119
5 SASI_Hs02_00336310 predicted 1015
6 SASI_Hs01_00234145 predicted 975
7 SASI_Hs02_00336311 predicted 644
8 SASI_Hs02_00336312 predicted 1158
9 SASI_Hs02_00336313 predicted 1165
10 SASI_Hs02_00336314 predicted 1093
11 SASI_Hs01_00234142 predicted 1079
12 SASI_Hs01_00234143 predicted 922
13 SASI_Hs01_00234144 predicted 1118
14 SASI_Hs01_00234146 predicted 978
15 SASI_Hs01_00234147 predicted 1064
16 SASI_Hs01_00234148 predicted 878
17 SASI_Hs01_00234149 predicted 1134
18 SASI_Hs01_00234150 predicted 911
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152827 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219542 predicted 742
2 SASI_Hs01_00219543 predicted 978
3 SASI_Hs01_00219544 predicted 815
4 SASI_Hs01_00219545 predicted 1014
5 SASI_Hs01_00219546 predicted 872
6 SASI_Hs01_00219547 predicted 861
7 SASI_Hs01_00219548 predicted 958
8 SASI_Hs01_00219549 predicted 769
9 SASI_Hs01_00219550 predicted 1019
10 SASI_Hs01_00219551 predicted 804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152828 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097728 predicted 944
2 SASI_Hs01_00097729 predicted 1169
3 SASI_Hs01_00097730 predicted 1004
4 SASI_Hs01_00097731 predicted 1069
5 SASI_Hs01_00097732 predicted 1065
6 SASI_Hs01_00097733 predicted 1148
7 SASI_Hs01_00097734 predicted 969
8 SASI_Hs01_00097735 predicted 998
9 SASI_Hs01_00097736 predicted 1012
10 SASI_Hs01_00097737 predicted 935
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044283 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205504 predicted 533
2 SASI_Rn02_00205505 predicted 952
3 SASI_Rn02_00205506 predicted 687
4 SASI_Rn02_00205507 predicted 842
5 SASI_Rn02_00205508 predicted 955
6 SASI_Rn02_00205509 predicted 857
7 SASI_Rn02_00205510 predicted 1143
8 SASI_Rn02_00205511 predicted 1069
9 SASI_Rn02_00205512 predicted 939
10 SASI_Rn02_00205513 predicted 542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017472 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129856 predicted 492
2 SASI_Mm01_00129859 predicted 421
3 SASI_Mm02_00323938 predicted 809
4 SASI_Mm01_00129860 predicted 465
5 SASI_Mm01_00129861 predicted 921
6 SASI_Mm01_00129862 predicted 829
7 SASI_Mm01_00129863 predicted 911
8 SASI_Mm01_00129864 predicted 961
9 SASI_Mm01_00129865 predicted 429
10 SASI_Mm02_00323939 predicted 812
11 SASI_Mm01_00129857 predicted 932
12 SASI_Mm01_00129858 predicted 1051
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003795
VALIDATED
SNX3 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 3
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003795.3-470s1c1
Sequence:CCGGCCGCTTCACCACTTACGAAATCTCGAGATTTCGTAAGTGGTGAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003795.3-582s1c1
Sequence:CCGGGAAAGAGAGAGCAAGGTCGTACTCGAGTACGACCTTGCTCTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003795.3-553s1c1
Sequence:CCGGGTGACTTTGAATGGCTGCGAACTCGAGTTCGCAGCCATTCAAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003795.3-749s1c1
Sequence:CCGGCGAACGTTGTCTTCACATGTTCTCGAGAACATGTGAAGACAACGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003795.3-873s1c1
Sequence:CCGGGCACCAGTGAAGAAGTTCTAACTCGAGTTAGAACTTCTTCACTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003795.3-708s1c1
Sequence:CCGGCAGTTTATAAACAAGGTCGCTCTCGAGAGCGACCTTGTTTATAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003795.3-750s1c1
Sequence:CCGGGAACGTTGTCTTCACATGTTTCTCGAGAAACATGTGAAGACAACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152068    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003795.3-876s1c1
Sequence:CCGGCCAGTGAAGAAGTTCTAACTTCTCGAGAAGTTAGAACTTCTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152595    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003795.3-904s1c1
Sequence:CCGGGCTGCACAGAAACTGGTATAACTCGAGTTATACCAGTTTCTGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003795.3-479s1c1
Sequence:CCGGCACTTACGAAATCAGGGTCAACTCGAGTTGACCCTGATTTCGTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003795.4-905s21c1
Sequence:CCGGGCTGCACAGAAACTGGTATAACTCGAGTTATACCAGTTTCTGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003795.4-583s21c1
Sequence:CCGGGAAAGAGAGAGCAAGGTCGTACTCGAGTACGACCTTGCTCTCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003795.4-874s21c1
Sequence:CCGGGCACCAGTGAAGAAGTTCTAACTCGAGTTAGAACTTCTTCACTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003795.4-471s21c1
Sequence:CCGGCCGCTTCACCACTTACGAAATCTCGAGATTTCGTAAGTGGTGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003795.4-751s21c1
Sequence:CCGGGAACGTTGTCTTCACATGTTTCTCGAGAAACATGTGAAGACAACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003795
VALIDATED
SNX3 MISSION shRNA shRNA Plasmid DNA
sorting nexin 3
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003795.3-470s1c1
Sequence:CCGGCCGCTTCACCACTTACGAAATCTCGAGATTTCGTAAGTGGTGAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003795.3-582s1c1
Sequence:CCGGGAAAGAGAGAGCAAGGTCGTACTCGAGTACGACCTTGCTCTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003795.3-553s1c1
Sequence:CCGGGTGACTTTGAATGGCTGCGAACTCGAGTTCGCAGCCATTCAAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003795.3-749s1c1
Sequence:CCGGCGAACGTTGTCTTCACATGTTCTCGAGAACATGTGAAGACAACGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003795.3-873s1c1
Sequence:CCGGGCACCAGTGAAGAAGTTCTAACTCGAGTTAGAACTTCTTCACTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003795.3-708s1c1
Sequence:CCGGCAGTTTATAAACAAGGTCGCTCTCGAGAGCGACCTTGTTTATAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003795.3-750s1c1
Sequence:CCGGGAACGTTGTCTTCACATGTTTCTCGAGAAACATGTGAAGACAACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152068    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003795.3-876s1c1
Sequence:CCGGCCAGTGAAGAAGTTCTAACTTCTCGAGAAGTTAGAACTTCTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152595    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003795.3-904s1c1
Sequence:CCGGGCTGCACAGAAACTGGTATAACTCGAGTTATACCAGTTTCTGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003795.3-479s1c1
Sequence:CCGGCACTTACGAAATCAGGGTCAACTCGAGTTGACCCTGATTTCGTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003795.4-905s21c1
Sequence:CCGGGCTGCACAGAAACTGGTATAACTCGAGTTATACCAGTTTCTGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003795.4-583s21c1
Sequence:CCGGGAAAGAGAGAGCAAGGTCGTACTCGAGTACGACCTTGCTCTCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003795.4-874s21c1
Sequence:CCGGGCACCAGTGAAGAAGTTCTAACTCGAGTTAGAACTTCTTCACTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003795.4-471s21c1
Sequence:CCGGCCGCTTCACCACTTACGAAATCTCGAGATTTCGTAAGTGGTGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003795.4-751s21c1
Sequence:CCGGGAACGTTGTCTTCACATGTTTCTCGAGAAACATGTGAAGACAACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003795
VALIDATED
SNX3 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 3
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003795.3-470s1c1
Sequence:CCGGCCGCTTCACCACTTACGAAATCTCGAGATTTCGTAAGTGGTGAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003795.3-582s1c1
Sequence:CCGGGAAAGAGAGAGCAAGGTCGTACTCGAGTACGACCTTGCTCTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003795.3-553s1c1
Sequence:CCGGGTGACTTTGAATGGCTGCGAACTCGAGTTCGCAGCCATTCAAAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003795.3-749s1c1
Sequence:CCGGCGAACGTTGTCTTCACATGTTCTCGAGAACATGTGAAGACAACGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152653    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003795.3-873s1c1
Sequence:CCGGGCACCAGTGAAGAAGTTCTAACTCGAGTTAGAACTTCTTCACTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003795.3-708s1c1
Sequence:CCGGCAGTTTATAAACAAGGTCGCTCTCGAGAGCGACCTTGTTTATAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003795.3-750s1c1
Sequence:CCGGGAACGTTGTCTTCACATGTTTCTCGAGAAACATGTGAAGACAACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152068    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003795.3-876s1c1
Sequence:CCGGCCAGTGAAGAAGTTCTAACTTCTCGAGAAGTTAGAACTTCTTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152595    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003795.3-904s1c1
Sequence:CCGGGCTGCACAGAAACTGGTATAACTCGAGTTATACCAGTTTCTGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003795.3-479s1c1
Sequence:CCGGCACTTACGAAATCAGGGTCAACTCGAGTTGACCCTGATTTCGTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003795.4-905s21c1
Sequence:CCGGGCTGCACAGAAACTGGTATAACTCGAGTTATACCAGTTTCTGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003795.4-583s21c1
Sequence:CCGGGAAAGAGAGAGCAAGGTCGTACTCGAGTACGACCTTGCTCTCTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003795.4-874s21c1
Sequence:CCGGGCACCAGTGAAGAAGTTCTAACTCGAGTTAGAACTTCTTCACTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003795.4-471s21c1
Sequence:CCGGCCGCTTCACCACTTACGAAATCTCGAGATTTCGTAAGTGGTGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003795.4-751s21c1
Sequence:CCGGGAACGTTGTCTTCACATGTTTCTCGAGAAACATGTGAAGACAACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017472
VALIDATED
SNX3 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 3
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017472.2-347s1c1
Sequence:CCGGGCAGAATCTGAATGACGCCTACTCGAGTAGGCGTCATTCAGATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_017472.2-549s1c1
Sequence:CCGGAGAGAGAGCAAGGTTGTAGTTCTCGAGAACTACAACCTTGCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_017472.2-705s1c1
Sequence:CCGGGCCCAGAATGAACGTTGTCTTCTCGAGAAGACAACGTTCATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_017472.2-837s1c1
Sequence:CCGGGCACCAATGAAGAAGTTGTAACTCGAGTTACAACTTCTTCATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_017472.2-665s1c1
Sequence:CCGGGCTGGAACAGTTCATAAACAACTCGAGTTGTTTATGAACTGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017472.4-309s21c1
Sequence:GTACCGGTCATCACCAAGCCGCAGAATCCTCGAGGATTCTGCGGCTTGGTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017472.4-640s21c1
Sequence:CCGGGCTGGAACAGTTCATAAACAACTCGAGTTGTTTATGAACTGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017472.4-524s21c1
Sequence:CCGGAGAGAGAGCAAGGTTGTAGTTCTCGAGAACTACAACCTTGCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017472.4-812s21c1
Sequence:CCGGGCACCAATGAAGAAGTTGTAACTCGAGTTACAACTTCTTCATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017472.4-680s21c1
Sequence:CCGGGCCCAGAATGAACGTTGTCTTCTCGAGAAGACAACGTTCATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017472.4-425s21c1
Sequence:GTACCGGGAGATCAGGGTCAAGACAAATCTCGAGATTTGTCTTGACCCTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017472
VALIDATED
SNX3 MISSION shRNA shRNA Plasmid DNA
sorting nexin 3
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017472.2-347s1c1
Sequence:CCGGGCAGAATCTGAATGACGCCTACTCGAGTAGGCGTCATTCAGATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_017472.2-549s1c1
Sequence:CCGGAGAGAGAGCAAGGTTGTAGTTCTCGAGAACTACAACCTTGCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_017472.2-705s1c1
Sequence:CCGGGCCCAGAATGAACGTTGTCTTCTCGAGAAGACAACGTTCATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_017472.2-837s1c1
Sequence:CCGGGCACCAATGAAGAAGTTGTAACTCGAGTTACAACTTCTTCATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_017472.2-665s1c1
Sequence:CCGGGCTGGAACAGTTCATAAACAACTCGAGTTGTTTATGAACTGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017472.4-309s21c1
Sequence:GTACCGGTCATCACCAAGCCGCAGAATCCTCGAGGATTCTGCGGCTTGGTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017472.4-640s21c1
Sequence:CCGGGCTGGAACAGTTCATAAACAACTCGAGTTGTTTATGAACTGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017472.4-524s21c1
Sequence:CCGGAGAGAGAGCAAGGTTGTAGTTCTCGAGAACTACAACCTTGCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017472.4-812s21c1
Sequence:CCGGGCACCAATGAAGAAGTTGTAACTCGAGTTACAACTTCTTCATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017472.4-680s21c1
Sequence:CCGGGCCCAGAATGAACGTTGTCTTCTCGAGAAGACAACGTTCATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017472.4-425s21c1
Sequence:GTACCGGGAGATCAGGGTCAAGACAAATCTCGAGATTTGTCTTGACCCTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017472
VALIDATED
SNX3 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 3
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017472.2-347s1c1
Sequence:CCGGGCAGAATCTGAATGACGCCTACTCGAGTAGGCGTCATTCAGATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_017472.2-549s1c1
Sequence:CCGGAGAGAGAGCAAGGTTGTAGTTCTCGAGAACTACAACCTTGCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_017472.2-705s1c1
Sequence:CCGGGCCCAGAATGAACGTTGTCTTCTCGAGAAGACAACGTTCATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093599    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_017472.2-837s1c1
Sequence:CCGGGCACCAATGAAGAAGTTGTAACTCGAGTTACAACTTCTTCATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_017472.2-665s1c1
Sequence:CCGGGCTGGAACAGTTCATAAACAACTCGAGTTGTTTATGAACTGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017472.4-309s21c1
Sequence:GTACCGGTCATCACCAAGCCGCAGAATCCTCGAGGATTCTGCGGCTTGGTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017472.4-640s21c1
Sequence:CCGGGCTGGAACAGTTCATAAACAACTCGAGTTGTTTATGAACTGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017472.4-524s21c1
Sequence:CCGGAGAGAGAGCAAGGTTGTAGTTCTCGAGAACTACAACCTTGCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317491    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017472.4-812s21c1
Sequence:CCGGGCACCAATGAAGAAGTTGTAACTCGAGTTACAACTTCTTCATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017472.4-680s21c1
Sequence:CCGGGCCCAGAATGAACGTTGTCTTCTCGAGAAGACAACGTTCATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017472.4-425s21c1
Sequence:GTACCGGGAGATCAGGGTCAAGACAAATCTCGAGATTTGTCTTGACCCTGATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks