EMAIL THIS PAGE TO A FRIEND

SNX4

sorting nexin 4

Synonyms: ATG24B
UniProtKB ID: O95219, B3KMH0, D3DNA3
Gene ID:
Human(8723) Summary: This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein associated with the long isoform of the leptin receptor and with receptor tyrosine kinases for platelet-derived growth factor, insulin, and epidermal growth factor in cell cultures, but its function is unknown. This protein may form oligomeric complexes with family members. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Nov 2012]
Mouse(69150) sorting nexin 4
Rat(360725) sorting nexin 4
Zebrafish(323203) sorting nexin 4
Horse(100060493) sorting nexin 4
domestic cat(101096408) sorting nexin 4
dog(478595) sorting nexin 4
chicken(424260) sorting nexin 4
cow(519597) sorting nexin 4
sheep(101117464) sorting nexin 4
Domestic Rabbit(100352021) sorting nexin 4
naked mole-rat(101704723) sorting nexin 4
138 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080557 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080557 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080557 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003794 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003794 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003794 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU033121 MISSION® esiRNA esiRNA human SNX4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003794 Rosetta Predictions human pricing
NM_001127550 Rosetta Predictions rat pricing
NM_080557 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003794 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242335 predicted 340
2 SASI_Hs01_00242336 predicted 1194
3 SASI_Hs02_00336306 predicted 1297
4 SASI_Hs01_00242337 predicted 1114
5 SASI_Hs01_00242338 predicted 825
6 SASI_Hs01_00242339 predicted 706
7 SASI_Hs01_00242340 predicted 305
8 SASI_Hs01_00242341 predicted 357
9 SASI_Hs01_00242342 predicted 1255
10 SASI_Hs01_00242343 predicted 931
11 SASI_Hs01_00242334 predicted 598
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127550 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254253 predicted 1279
2 SASI_Rn02_00254254 predicted 1362
3 SASI_Rn02_00254255 predicted 1078
4 SASI_Rn02_00254256 predicted 1250
5 SASI_Rn02_00254257 predicted 251
6 SASI_Rn02_00254258 predicted 746
7 SASI_Rn02_00254259 predicted 1050
8 SASI_Rn02_00254260 predicted 1071
9 SASI_Rn02_00254261 predicted 418
10 SASI_Rn02_00254262 predicted 1405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080557 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105081 predicted 1328
2 SASI_Mm02_00338157 predicted 1310
3 SASI_Mm01_00105082 predicted 1411
4 SASI_Mm01_00105083 predicted 647
5 SASI_Mm01_00105085 predicted 1279
6 SASI_Mm01_00105086 predicted 1072
7 SASI_Mm01_00105087 predicted 1248
8 SASI_Mm02_00338158 predicted 1050
9 SASI_Mm01_00105088 predicted 794
10 SASI_Mm02_00338159 predicted 1427
11 SASI_Mm01_00105084 predicted 1056
12 SASI_Mm01_00105089 predicted 754
13 SASI_Mm01_00105090 predicted 1076
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080557
VALIDATED
SNX4 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093249    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080557.1-1960s1c1
Sequence:CCGGGCAGTGGAATAGATACATTATCTCGAGATAATGTATCTATTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080557.1-140s1c1
Sequence:CCGGCGACACGATGACGGGAAATAACTCGAGTTATTTCCCGTCATCGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080557.1-1218s1c1
Sequence:CCGGGCTGATATTGAACGCTTCAAACTCGAGTTTGAAGCGTTCAATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080557.1-741s1c1
Sequence:CCGGGATCGACTCTATGGTGTATATCTCGAGATATACACCATAGAGTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080557.1-405s1c1
Sequence:CCGGGCAGAGTTCGTGTGGCATAAACTCGAGTTTATGCCACACGAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080557
VALIDATED
SNX4 MISSION shRNA shRNA Plasmid DNA
sorting nexin 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093249    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080557.1-1960s1c1
Sequence:CCGGGCAGTGGAATAGATACATTATCTCGAGATAATGTATCTATTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080557.1-140s1c1
Sequence:CCGGCGACACGATGACGGGAAATAACTCGAGTTATTTCCCGTCATCGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080557.1-1218s1c1
Sequence:CCGGGCTGATATTGAACGCTTCAAACTCGAGTTTGAAGCGTTCAATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080557.1-741s1c1
Sequence:CCGGGATCGACTCTATGGTGTATATCTCGAGATATACACCATAGAGTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080557.1-405s1c1
Sequence:CCGGGCAGAGTTCGTGTGGCATAAACTCGAGTTTATGCCACACGAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080557
VALIDATED
SNX4 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093249    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080557.1-1960s1c1
Sequence:CCGGGCAGTGGAATAGATACATTATCTCGAGATAATGTATCTATTCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080557.1-140s1c1
Sequence:CCGGCGACACGATGACGGGAAATAACTCGAGTTATTTCCCGTCATCGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080557.1-1218s1c1
Sequence:CCGGGCTGATATTGAACGCTTCAAACTCGAGTTTGAAGCGTTCAATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080557.1-741s1c1
Sequence:CCGGGATCGACTCTATGGTGTATATCTCGAGATATACACCATAGAGTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080557.1-405s1c1
Sequence:CCGGGCAGAGTTCGTGTGGCATAAACTCGAGTTTATGCCACACGAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003794
VALIDATED
SNX4 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003794.2-1364s1c1
Sequence:CCGGCCAATGCTAAGGAATGCTTTACTCGAGTAAAGCATTCCTTAGCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003794.2-354s1c1
Sequence:CCGGGCGGCGATATAGTGAATTTGACTCGAGTCAAATTCACTATATCGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147915    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_003794.2-1536s1c1
Sequence:CCGGGTCGTGTTAATGTAGCACAAACTCGAGTTTGTGCTACATTAACACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003794.2-2128s1c1
Sequence:CCGGCCTCAGTAATGAGCCTAAATTCTCGAGAATTTAGGCTCATTACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003794.2-177s1c1
Sequence:CCGGCGACACGATGACACACAATAACTCGAGTTATTGTGTGTCATCGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146687    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003794.2-1825s1c1
Sequence:CCGGCTTGCCTTATAGTTGAGCTATCTCGAGATAGCTCAACTATAAGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003794.2-1196s1c1
Sequence:CCGGGAGAACAACAGCTAAAGTCTACTCGAGTAGACTTTAGCTGTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_003794.2-1255s1c1
Sequence:CCGGGCTGATATTGAACGCTTCAAACTCGAGTTTGAAGCGTTCAATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003794.2-778s1c1
Sequence:CCGGGATCGACTCTATGGTGTATATCTCGAGATATACACCATAGAGTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003794.2-1305s1c1
Sequence:CCGGCCTCATAAGCTATGCAGTCATCTCGAGATGACTGCATAGCTTATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003794.2-1362s1c1
Sequence:CCGGGACCAATGCTAAGGAATGCTTCTCGAGAAGCATTCCTTAGCATTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003794
VALIDATED
SNX4 MISSION shRNA shRNA Plasmid DNA
sorting nexin 4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003794.2-1364s1c1
Sequence:CCGGCCAATGCTAAGGAATGCTTTACTCGAGTAAAGCATTCCTTAGCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003794.2-354s1c1
Sequence:CCGGGCGGCGATATAGTGAATTTGACTCGAGTCAAATTCACTATATCGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147915    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_003794.2-1536s1c1
Sequence:CCGGGTCGTGTTAATGTAGCACAAACTCGAGTTTGTGCTACATTAACACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003794.2-2128s1c1
Sequence:CCGGCCTCAGTAATGAGCCTAAATTCTCGAGAATTTAGGCTCATTACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003794.2-177s1c1
Sequence:CCGGCGACACGATGACACACAATAACTCGAGTTATTGTGTGTCATCGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146687    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003794.2-1825s1c1
Sequence:CCGGCTTGCCTTATAGTTGAGCTATCTCGAGATAGCTCAACTATAAGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003794.2-1196s1c1
Sequence:CCGGGAGAACAACAGCTAAAGTCTACTCGAGTAGACTTTAGCTGTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_003794.2-1255s1c1
Sequence:CCGGGCTGATATTGAACGCTTCAAACTCGAGTTTGAAGCGTTCAATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003794.2-778s1c1
Sequence:CCGGGATCGACTCTATGGTGTATATCTCGAGATATACACCATAGAGTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003794.2-1305s1c1
Sequence:CCGGCCTCATAAGCTATGCAGTCATCTCGAGATGACTGCATAGCTTATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003794.2-1362s1c1
Sequence:CCGGGACCAATGCTAAGGAATGCTTCTCGAGAAGCATTCCTTAGCATTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003794
VALIDATED
SNX4 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003794.2-1364s1c1
Sequence:CCGGCCAATGCTAAGGAATGCTTTACTCGAGTAAAGCATTCCTTAGCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003794.2-354s1c1
Sequence:CCGGGCGGCGATATAGTGAATTTGACTCGAGTCAAATTCACTATATCGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147915    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_003794.2-1536s1c1
Sequence:CCGGGTCGTGTTAATGTAGCACAAACTCGAGTTTGTGCTACATTAACACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146780    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003794.2-2128s1c1
Sequence:CCGGCCTCAGTAATGAGCCTAAATTCTCGAGAATTTAGGCTCATTACTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003794.2-177s1c1
Sequence:CCGGCGACACGATGACACACAATAACTCGAGTTATTGTGTGTCATCGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146687    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003794.2-1825s1c1
Sequence:CCGGCTTGCCTTATAGTTGAGCTATCTCGAGATAGCTCAACTATAAGGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003794.2-1196s1c1
Sequence:CCGGGAGAACAACAGCTAAAGTCTACTCGAGTAGACTTTAGCTGTTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_003794.2-1255s1c1
Sequence:CCGGGCTGATATTGAACGCTTCAAACTCGAGTTTGAAGCGTTCAATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003794.2-778s1c1
Sequence:CCGGGATCGACTCTATGGTGTATATCTCGAGATATACACCATAGAGTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003794.2-1305s1c1
Sequence:CCGGCCTCATAAGCTATGCAGTCATCTCGAGATGACTGCATAGCTTATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003794.2-1362s1c1
Sequence:CCGGGACCAATGCTAAGGAATGCTTCTCGAGAAGCATTCCTTAGCATTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks