EMAIL THIS PAGE TO A FRIEND

SNX5

sorting nexin 5

UniProtKB ID: Q9Y5X3, B7ZKN3, D3DW26, Q52LC4, Q9BWP0
Gene ID:
Human(27131) Summary: This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein binds to fanconi anemia complementation group A protein, but its function is unknown. This gene results in two transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Mouse(69178) sorting nexin 5
Rat(296199) sorting nexin 5
naked mole-rat(101714241) sorting nexin 5
cow(514423) sorting nexin 5
sheep(101120428) sorting nexin 5
Zebrafish(406797) sorting nexin 5
Horse(100062401) sorting nexin 5
domestic cat(101081376) sorting nexin 5
dog(485754) sorting nexin 5
chicken(416718) sorting nexin 5
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152227 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152227 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152227 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024225 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024225 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024225 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014426 Rosetta Predictions human pricing
NM_152227 Rosetta Predictions human pricing
NM_001106518 Rosetta Predictions rat pricing
NM_024225 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063807 predicted 553
2 SASI_Hs02_00345627 predicted 248
3 SASI_Hs02_00345628 predicted 310
4 SASI_Hs02_00345629 predicted 827
5 SASI_Hs01_00063810 predicted 474
6 SASI_Hs01_00063811 predicted 715
7 SASI_Hs01_00063812 predicted 733
8 SASI_Hs02_00345630 predicted 834
9 SASI_Hs02_00345631 predicted 718
10 SASI_Hs02_00345632 predicted 827
11 SASI_Hs01_00063806 predicted 920
12 SASI_Hs01_00063808 predicted 318
13 SASI_Hs01_00063809 predicted 690
14 SASI_Hs01_00063813 predicted 1372
15 SASI_Hs01_00063814 predicted 624
16 SASI_Hs01_00063815 predicted 942
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152227 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013765 predicted 639
2 SASI_Hs02_00365719 predicted 341
3 SASI_Hs02_00365720 predicted 404
4 SASI_Hs02_00365721 predicted 918
5 SASI_Hs01_00013768 predicted 561
6 SASI_Hs01_00013769 predicted 815
7 SASI_Hs01_00013770 predicted 827
8 SASI_Hs02_00365722 predicted 921
9 SASI_Hs02_00365723 predicted 807
10 SASI_Hs02_00365724 predicted 927
11 SASI_Hs01_00013764 predicted 1007
12 SASI_Hs01_00013766 predicted 418
13 SASI_Hs01_00013767 predicted 780
14 SASI_Hs01_00013771 predicted 1465
15 SASI_Hs01_00013772 predicted 716
16 SASI_Hs01_00013773 predicted 1037
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106518 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219748 predicted 1093
2 SASI_Rn02_00219749 predicted 1090
3 SASI_Rn02_00219750 predicted 1303
4 SASI_Rn02_00219751 predicted 1292
5 SASI_Rn02_00219752 predicted 1411
6 SASI_Rn02_00219753 predicted 821
7 SASI_Rn02_00219754 predicted 1031
8 SASI_Rn02_00219755 predicted 1429
9 SASI_Rn02_00219756 predicted 746
10 SASI_Rn02_00219757 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024225 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185454 predicted 329
2 SASI_Mm01_00185456 predicted 986
3 SASI_Mm01_00185457 predicted 613
4 SASI_Mm01_00185458 predicted 285
5 SASI_Mm01_00185459 predicted 700
6 SASI_Mm01_00185460 predicted 600
7 SASI_Mm01_00185461 predicted 489
8 SASI_Mm02_00327596 predicted 562
9 SASI_Mm01_00185462 predicted 768
10 SASI_Mm01_00185463 predicted 223
11 SASI_Mm01_00185455 predicted 1021
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152227
VALIDATED
SNX5 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 5
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149876    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_152227.1-1691s1c1
Sequence:CCGGGCCTTCTGGAAACAAGTAGAACTCGAGTTCTACTTGTTTCCAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_152227.1-569s1c1
Sequence:CCGGCTGAGTATCTCGCTGTGTTTACTCGAGTAAACACAGCGAGATACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148896    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152227.1-1645s1c1
Sequence:CCGGCCCGTAGTTCGTCTTTAGTTACTCGAGTAACTAAAGACGAACTACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_152227.1-1024s1c1
Sequence:CCGGCGAGTTTCATCAGATGAAGATCTCGAGATCTTCATCTGATGAAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152227.1-1869s21c1
Sequence:GTACCGGATCTGGTGTTTGTACTATAACCTCGAGGTTATAGTACAAACACCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232624    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152227.1-1574s21c1
Sequence:CCGGTGCTACTTGGACATAACTAATCTCGAGATTAGTTATGTCCAAGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_152227.1-980s21c1
Sequence:CCGGTGAAGGTTGCTGAGCTATTTGCTCGAGCAAATAGCTCAGCAACCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_152227.1-833s21c1
Sequence:CCGGACTATTACAATAGGATCAAAGCTCGAGCTTTGATCCTATTGTAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_152227.1-429s21c1
Sequence:CCGGAGACTATGCTGGGCTTATTATCTCGAGATAATAAGCCCAGCATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_152227.1-266s21c1
Sequence:CCGGCCTCGCTTCAGATTGACATACCTCGAGGTATGTCAATCTGAAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152227.1-1641s21c1
Sequence:GTACCGGTTCTCCCGTAGTTCGTCTTTACTCGAGTAAAGACGAACTACGGGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152227.1-1729s21c1
Sequence:GTACCGGGTCCCTACAAACCCATGATTGCTCGAGCAATCATGGGTTTGTAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152227
VALIDATED
SNX5 MISSION shRNA shRNA Plasmid DNA
sorting nexin 5
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149876    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_152227.1-1691s1c1
Sequence:CCGGGCCTTCTGGAAACAAGTAGAACTCGAGTTCTACTTGTTTCCAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_152227.1-569s1c1
Sequence:CCGGCTGAGTATCTCGCTGTGTTTACTCGAGTAAACACAGCGAGATACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148896    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152227.1-1645s1c1
Sequence:CCGGCCCGTAGTTCGTCTTTAGTTACTCGAGTAACTAAAGACGAACTACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_152227.1-1024s1c1
Sequence:CCGGCGAGTTTCATCAGATGAAGATCTCGAGATCTTCATCTGATGAAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152227.1-1869s21c1
Sequence:GTACCGGATCTGGTGTTTGTACTATAACCTCGAGGTTATAGTACAAACACCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232624    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152227.1-1574s21c1
Sequence:CCGGTGCTACTTGGACATAACTAATCTCGAGATTAGTTATGTCCAAGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_152227.1-980s21c1
Sequence:CCGGTGAAGGTTGCTGAGCTATTTGCTCGAGCAAATAGCTCAGCAACCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_152227.1-833s21c1
Sequence:CCGGACTATTACAATAGGATCAAAGCTCGAGCTTTGATCCTATTGTAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_152227.1-429s21c1
Sequence:CCGGAGACTATGCTGGGCTTATTATCTCGAGATAATAAGCCCAGCATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_152227.1-266s21c1
Sequence:CCGGCCTCGCTTCAGATTGACATACCTCGAGGTATGTCAATCTGAAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152227.1-1641s21c1
Sequence:GTACCGGTTCTCCCGTAGTTCGTCTTTACTCGAGTAAAGACGAACTACGGGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152227.1-1729s21c1
Sequence:GTACCGGGTCCCTACAAACCCATGATTGCTCGAGCAATCATGGGTTTGTAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152227
VALIDATED
SNX5 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 5
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149876    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_152227.1-1691s1c1
Sequence:CCGGGCCTTCTGGAAACAAGTAGAACTCGAGTTCTACTTGTTTCCAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_152227.1-569s1c1
Sequence:CCGGCTGAGTATCTCGCTGTGTTTACTCGAGTAAACACAGCGAGATACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148896    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152227.1-1645s1c1
Sequence:CCGGCCCGTAGTTCGTCTTTAGTTACTCGAGTAACTAAAGACGAACTACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_152227.1-1024s1c1
Sequence:CCGGCGAGTTTCATCAGATGAAGATCTCGAGATCTTCATCTGATGAAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152227.1-1869s21c1
Sequence:GTACCGGATCTGGTGTTTGTACTATAACCTCGAGGTTATAGTACAAACACCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232624    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152227.1-1574s21c1
Sequence:CCGGTGCTACTTGGACATAACTAATCTCGAGATTAGTTATGTCCAAGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_152227.1-980s21c1
Sequence:CCGGTGAAGGTTGCTGAGCTATTTGCTCGAGCAAATAGCTCAGCAACCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_152227.1-833s21c1
Sequence:CCGGACTATTACAATAGGATCAAAGCTCGAGCTTTGATCCTATTGTAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_152227.1-429s21c1
Sequence:CCGGAGACTATGCTGGGCTTATTATCTCGAGATAATAAGCCCAGCATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_152227.1-266s21c1
Sequence:CCGGCCTCGCTTCAGATTGACATACCTCGAGGTATGTCAATCTGAAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152227.1-1641s21c1
Sequence:GTACCGGTTCTCCCGTAGTTCGTCTTTACTCGAGTAAAGACGAACTACGGGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381002    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152227.1-1729s21c1
Sequence:GTACCGGGTCCCTACAAACCCATGATTGCTCGAGCAATCATGGGTTTGTAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024225
VALIDATED
SNX5 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 5
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093394    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024225.2-2047s1c1
Sequence:CCGGCCCTCTTGTAACCTTTACTAACTCGAGTTAGTAAAGGTTACAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024225.2-493s1c1
Sequence:CCGGGCTGAGTATCTCGCTGTCTTTCTCGAGAAAGACAGCGAGATACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024225.2-991s1c1
Sequence:CCGGCGATACTACATGCTCAACATACTCGAGTATGTTGAGCATGTAGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024225.2-382s1c1
Sequence:CCGGGCTCCTACAAAGCCAGACTTTCTCGAGAAAGTCTGGCTTTGTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024225.2-1048s1c1
Sequence:CCGGGCCCTAATTGACTATGAGAATCTCGAGATTCTCATAGTCAATTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024225.4-1285s21c1
Sequence:GTACCGGTGCAGAGCTGCATCGACTTATCTCGAGATAAGTCGATGCAGCTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024225.4-1358s21c1
Sequence:GTACCGGTCACTTGCACTTAAATCATTACTCGAGTAATGATTTAAGTGCAAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024225.4-353s21c1
Sequence:CCGGGGATTATGCTGGCCTTATTATCTCGAGATAATAAGGCCAGCATAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024225.4-1485s21c1
Sequence:CCGGTGTTACTTGGACATAACTAATCTCGAGATTAGTTATGTCCAAGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024225.4-1047s21c1
Sequence:CCGGGCCCTAATTGACTATGAGAATCTCGAGATTCTCATAGTCAATTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024225.4-190s21c1
Sequence:CCGGCATCGCTTCAGATCGACATACCTCGAGGTATGTCGATCTGAAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024225.4-492s21c1
Sequence:CCGGGCTGAGTATCTCGCTGTCTTTCTCGAGAAAGACAGCGAGATACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024225.4-1792s21c1
Sequence:GTACCGGACAAGCAAGAAGATCTCATATCTCGAGATATGAGATCTTCTTGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024225
VALIDATED
SNX5 MISSION shRNA shRNA Plasmid DNA
sorting nexin 5
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093394    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024225.2-2047s1c1
Sequence:CCGGCCCTCTTGTAACCTTTACTAACTCGAGTTAGTAAAGGTTACAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024225.2-493s1c1
Sequence:CCGGGCTGAGTATCTCGCTGTCTTTCTCGAGAAAGACAGCGAGATACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024225.2-991s1c1
Sequence:CCGGCGATACTACATGCTCAACATACTCGAGTATGTTGAGCATGTAGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024225.2-382s1c1
Sequence:CCGGGCTCCTACAAAGCCAGACTTTCTCGAGAAAGTCTGGCTTTGTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024225.2-1048s1c1
Sequence:CCGGGCCCTAATTGACTATGAGAATCTCGAGATTCTCATAGTCAATTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024225.4-1285s21c1
Sequence:GTACCGGTGCAGAGCTGCATCGACTTATCTCGAGATAAGTCGATGCAGCTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024225.4-1358s21c1
Sequence:GTACCGGTCACTTGCACTTAAATCATTACTCGAGTAATGATTTAAGTGCAAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024225.4-353s21c1
Sequence:CCGGGGATTATGCTGGCCTTATTATCTCGAGATAATAAGGCCAGCATAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024225.4-1485s21c1
Sequence:CCGGTGTTACTTGGACATAACTAATCTCGAGATTAGTTATGTCCAAGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024225.4-1047s21c1
Sequence:CCGGGCCCTAATTGACTATGAGAATCTCGAGATTCTCATAGTCAATTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024225.4-190s21c1
Sequence:CCGGCATCGCTTCAGATCGACATACCTCGAGGTATGTCGATCTGAAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024225.4-492s21c1
Sequence:CCGGGCTGAGTATCTCGCTGTCTTTCTCGAGAAAGACAGCGAGATACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024225.4-1792s21c1
Sequence:GTACCGGACAAGCAAGAAGATCTCATATCTCGAGATATGAGATCTTCTTGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024225
VALIDATED
SNX5 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 5
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093394    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024225.2-2047s1c1
Sequence:CCGGCCCTCTTGTAACCTTTACTAACTCGAGTTAGTAAAGGTTACAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024225.2-493s1c1
Sequence:CCGGGCTGAGTATCTCGCTGTCTTTCTCGAGAAAGACAGCGAGATACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024225.2-991s1c1
Sequence:CCGGCGATACTACATGCTCAACATACTCGAGTATGTTGAGCATGTAGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024225.2-382s1c1
Sequence:CCGGGCTCCTACAAAGCCAGACTTTCTCGAGAAAGTCTGGCTTTGTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024225.2-1048s1c1
Sequence:CCGGGCCCTAATTGACTATGAGAATCTCGAGATTCTCATAGTCAATTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024225.4-1285s21c1
Sequence:GTACCGGTGCAGAGCTGCATCGACTTATCTCGAGATAAGTCGATGCAGCTCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380414    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024225.4-1358s21c1
Sequence:GTACCGGTCACTTGCACTTAAATCATTACTCGAGTAATGATTTAAGTGCAAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024225.4-353s21c1
Sequence:CCGGGGATTATGCTGGCCTTATTATCTCGAGATAATAAGGCCAGCATAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024225.4-1485s21c1
Sequence:CCGGTGTTACTTGGACATAACTAATCTCGAGATTAGTTATGTCCAAGTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024225.4-1047s21c1
Sequence:CCGGGCCCTAATTGACTATGAGAATCTCGAGATTCTCATAGTCAATTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024225.4-190s21c1
Sequence:CCGGCATCGCTTCAGATCGACATACCTCGAGGTATGTCGATCTGAAGCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024225.4-492s21c1
Sequence:CCGGGCTGAGTATCTCGCTGTCTTTCTCGAGAAAGACAGCGAGATACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024225.4-1792s21c1
Sequence:GTACCGGACAAGCAAGAAGATCTCATATCTCGAGATATGAGATCTTCTTGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks