EMAIL THIS PAGE TO A FRIEND

SNX6

sorting nexin 6

Synonyms: MSTP010 TFAF2
UniProtKB ID: Q9UNH7, C0H5W9, Q9Y449
Gene ID:
Human(58533) Summary: This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein associates with the long isoform of the leptin receptor, the transforming growth factor-beta family of receptor serine-threonine kinases, and with receptor tyrosine kinases for platelet-derived growth factor, insulin, and epidermal growth factor. This protein may form oligomeric complexes with family member proteins through interactions of both the PX domain and the coiled coil regions of the molecules. Translocation of this protein from the cytoplasm to the nucleus occurs after binding to proviral integration site 1 protein. This gene results in two transcripts encoding two distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(72183) sorting nexin 6
Rat(362738) sorting nexin 6
fruit fly(34126) CG8282 gene product from transcript CG8282-RA
domestic cat(101082830) sorting nexin 6
dog(490648) sorting nexin 6
chicken(771038) sorting nexin 6
Zebrafish(567182) sorting nexin 6
cow(532685) sorting nexin 6
sheep(101118137) sorting nexin 6
naked mole-rat(101716031) sorting nexin 6
164 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021249 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021249 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021249 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026998 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026998 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026998 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021249 Rosetta Predictions human pricing
NM_152233 Rosetta Predictions human pricing
NM_001108711 Rosetta Predictions rat pricing
NM_026998 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021249 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242558 predicted 1056
2 SASI_Hs01_00242559 predicted 1152
3 SASI_Hs01_00242560 predicted 951
4 SASI_Hs01_00242561 predicted 1436
5 SASI_Hs01_00242562 predicted 1081
6 SASI_Hs01_00242563 predicted 1166
7 SASI_Hs01_00242564 predicted 1273
8 SASI_Hs02_00354908 predicted 1085
9 SASI_Hs01_00242565 predicted 1070
10 SASI_Hs01_00242566 predicted 1164
11 SASI_Hs01_00242567 predicted 1332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152233 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083280 predicted 953
2 SASI_Hs02_00365732 predicted 900
3 SASI_Hs01_00083281 predicted 1044
4 SASI_Hs01_00083282 predicted 847
5 SASI_Hs01_00083284 predicted 296
6 SASI_Hs02_00365733 predicted 1067
7 SASI_Hs01_00083285 predicted 970
8 SASI_Hs01_00083287 predicted 1061
9 SASI_Hs01_00083288 predicted 816
10 SASI_Hs02_00365734 predicted 1049
11 SASI_Hs01_00083283 predicted 1342
12 SASI_Hs01_00083286 predicted 1009
13 SASI_Hs01_00083289 predicted 1217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108711 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241325 predicted 1192
2 SASI_Rn02_00241326 predicted 960
3 SASI_Rn02_00241327 predicted 1075
4 SASI_Rn02_00241328 predicted 808
5 SASI_Rn02_00241329 predicted 241
6 SASI_Rn02_00241330 predicted 985
7 SASI_Rn02_00241331 predicted 1225
8 SASI_Rn02_00241332 predicted 1177
9 SASI_Rn02_00241333 predicted 1063
10 SASI_Rn02_00241334 predicted 1296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026998 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074830 predicted 206
2 SASI_Mm01_00074831 predicted 1037
3 SASI_Mm01_00074832 predicted 922
4 SASI_Mm01_00074833 predicted 1021
5 SASI_Mm01_00074834 predicted 778
6 SASI_Mm01_00074835 predicted 1300
7 SASI_Mm01_00074836 predicted 1505
8 SASI_Mm01_00074837 predicted 255
9 SASI_Mm01_00074838 predicted 972
10 SASI_Mm02_00331355 predicted 1216
11 SASI_Mm01_00074829 predicted 1469
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021249
VALIDATED
SNX6 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 6
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021249.3-1837s21c1
Sequence:GTACCGGAGCATCTTAATCAGACTTATTCTCGAGAATAAGTCTGATTAAGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021249.3-1167s21c1
Sequence:CCGGGCCGAAACTTCCCAACAATTACTCGAGTAATTGTTGGGAAGTTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021249.3-1290s21c1
Sequence:CCGGGCAGAGTTAGAACTGAAGCATCTCGAGATGCTTCAGTTCTAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021249.3-803s21c1
Sequence:CCGGGGAGTATCATAACCGAGTTAACTCGAGTTAACTCGGTTATGATACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021249.3-755s21c1
Sequence:GTACCGGAGTAAAGGATGTAGATGATTTCTCGAGAAATCATCTACATCCTTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021249.3-777s21c1
Sequence:CCGGTTTGAGCACGAACGAACATTTCTCGAGAAATGTTCGTTCGTGCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021249.3-956s21c1
Sequence:GTACCGGAGTTTCAGAACTGTTCGATAACTCGAGTTATCGAACAGTTCTGAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021249.2-2471s1c1
Sequence:CCGGCGCCAGTAGTTATATTACAAACTCGAGTTTGTAATATAACTACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021249.2-1348s1c1
Sequence:CCGGCAGTGTTAAATGGAGACACATCTCGAGATGTGTCTCCATTTAACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021249.2-1167s1c1
Sequence:CCGGGCCGAAACTTCCCAACAATTACTCGAGTAATTGTTGGGAAGTTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_021249.2-1290s1c1
Sequence:CCGGGCAGAGTTAGAACTGAAGCATCTCGAGATGCTTCAGTTCTAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_021249.2-1005s1c1
Sequence:CCGGGCTGATGAAGACCTCAAACTTCTCGAGAAGTTTGAGGTCTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021249
VALIDATED
SNX6 MISSION shRNA shRNA Plasmid DNA
sorting nexin 6
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021249.3-1837s21c1
Sequence:GTACCGGAGCATCTTAATCAGACTTATTCTCGAGAATAAGTCTGATTAAGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021249.3-1167s21c1
Sequence:CCGGGCCGAAACTTCCCAACAATTACTCGAGTAATTGTTGGGAAGTTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021249.3-1290s21c1
Sequence:CCGGGCAGAGTTAGAACTGAAGCATCTCGAGATGCTTCAGTTCTAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021249.3-803s21c1
Sequence:CCGGGGAGTATCATAACCGAGTTAACTCGAGTTAACTCGGTTATGATACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021249.3-755s21c1
Sequence:GTACCGGAGTAAAGGATGTAGATGATTTCTCGAGAAATCATCTACATCCTTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021249.3-777s21c1
Sequence:CCGGTTTGAGCACGAACGAACATTTCTCGAGAAATGTTCGTTCGTGCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021249.3-956s21c1
Sequence:GTACCGGAGTTTCAGAACTGTTCGATAACTCGAGTTATCGAACAGTTCTGAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021249.2-2471s1c1
Sequence:CCGGCGCCAGTAGTTATATTACAAACTCGAGTTTGTAATATAACTACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021249.2-1348s1c1
Sequence:CCGGCAGTGTTAAATGGAGACACATCTCGAGATGTGTCTCCATTTAACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021249.2-1167s1c1
Sequence:CCGGGCCGAAACTTCCCAACAATTACTCGAGTAATTGTTGGGAAGTTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_021249.2-1290s1c1
Sequence:CCGGGCAGAGTTAGAACTGAAGCATCTCGAGATGCTTCAGTTCTAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_021249.2-1005s1c1
Sequence:CCGGGCTGATGAAGACCTCAAACTTCTCGAGAAGTTTGAGGTCTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021249
VALIDATED
SNX6 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 6
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021249.3-1837s21c1
Sequence:GTACCGGAGCATCTTAATCAGACTTATTCTCGAGAATAAGTCTGATTAAGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021249.3-1167s21c1
Sequence:CCGGGCCGAAACTTCCCAACAATTACTCGAGTAATTGTTGGGAAGTTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021249.3-1290s21c1
Sequence:CCGGGCAGAGTTAGAACTGAAGCATCTCGAGATGCTTCAGTTCTAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021249.3-803s21c1
Sequence:CCGGGGAGTATCATAACCGAGTTAACTCGAGTTAACTCGGTTATGATACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021249.3-755s21c1
Sequence:GTACCGGAGTAAAGGATGTAGATGATTTCTCGAGAAATCATCTACATCCTTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021249.3-777s21c1
Sequence:CCGGTTTGAGCACGAACGAACATTTCTCGAGAAATGTTCGTTCGTGCTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021249.3-956s21c1
Sequence:GTACCGGAGTTTCAGAACTGTTCGATAACTCGAGTTATCGAACAGTTCTGAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065173    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021249.2-2471s1c1
Sequence:CCGGCGCCAGTAGTTATATTACAAACTCGAGTTTGTAATATAACTACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021249.2-1348s1c1
Sequence:CCGGCAGTGTTAAATGGAGACACATCTCGAGATGTGTCTCCATTTAACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021249.2-1167s1c1
Sequence:CCGGGCCGAAACTTCCCAACAATTACTCGAGTAATTGTTGGGAAGTTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_021249.2-1290s1c1
Sequence:CCGGGCAGAGTTAGAACTGAAGCATCTCGAGATGCTTCAGTTCTAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_021249.2-1005s1c1
Sequence:CCGGGCTGATGAAGACCTCAAACTTCTCGAGAAGTTTGAGGTCTTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026998
VALIDATED
SNX6 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026998.3-878s21c1
Sequence:CCGGTCAAGCTCTCTGACCTATTAACTCGAGTTAATAGGTCAGAGAGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313601    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026998.3-1638s21c1
Sequence:CCGGTATCTGTGTAAAGCGTCTTAACTCGAGTTAAGACGCTTTACACAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026998.3-663s21c1
Sequence:CCGGAGAGTATCACAACCGAGTTAACTCGAGTTAACTCGGTTGTGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026998.3-458s21c1
Sequence:CCGGGGGTTGCAGCGCATCCTATTTCTCGAGAAATAGGATGCGCTGCAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026998.3-155s21c1
Sequence:CCGGCCGTTCACACAAAGAGTTCATCTCGAGATGAACTCTTTGTGTGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026998.2-1469s1c1
Sequence:CCGGCCTGTCTTACTGTGTTTATTTCTCGAGAAATAAACACAGTAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026998.2-59s1c1
Sequence:CCGGCGCGGACTTAAAGCAATAAATCTCGAGATTTATTGCTTTAAGTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026998.2-156s1c1
Sequence:CCGGCCGTTCACACAAAGAGTTCATCTCGAGATGAACTCTTTGTGTGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026998.2-1151s1c1
Sequence:CCGGGCAGAACTAGAACTGAAGCATCTCGAGATGCTTCAGTTCTAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026998.2-1039s1c1
Sequence:CCGGCCAACAGTTGTGCTGTCAGAACTCGAGTTCTGACAGCACAACTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026998
VALIDATED
SNX6 MISSION shRNA shRNA Plasmid DNA
sorting nexin 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026998.3-878s21c1
Sequence:CCGGTCAAGCTCTCTGACCTATTAACTCGAGTTAATAGGTCAGAGAGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313601    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026998.3-1638s21c1
Sequence:CCGGTATCTGTGTAAAGCGTCTTAACTCGAGTTAAGACGCTTTACACAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026998.3-663s21c1
Sequence:CCGGAGAGTATCACAACCGAGTTAACTCGAGTTAACTCGGTTGTGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026998.3-458s21c1
Sequence:CCGGGGGTTGCAGCGCATCCTATTTCTCGAGAAATAGGATGCGCTGCAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026998.3-155s21c1
Sequence:CCGGCCGTTCACACAAAGAGTTCATCTCGAGATGAACTCTTTGTGTGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026998.2-1469s1c1
Sequence:CCGGCCTGTCTTACTGTGTTTATTTCTCGAGAAATAAACACAGTAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026998.2-59s1c1
Sequence:CCGGCGCGGACTTAAAGCAATAAATCTCGAGATTTATTGCTTTAAGTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026998.2-156s1c1
Sequence:CCGGCCGTTCACACAAAGAGTTCATCTCGAGATGAACTCTTTGTGTGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026998.2-1151s1c1
Sequence:CCGGGCAGAACTAGAACTGAAGCATCTCGAGATGCTTCAGTTCTAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026998.2-1039s1c1
Sequence:CCGGCCAACAGTTGTGCTGTCAGAACTCGAGTTCTGACAGCACAACTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026998
VALIDATED
SNX6 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026998.3-878s21c1
Sequence:CCGGTCAAGCTCTCTGACCTATTAACTCGAGTTAATAGGTCAGAGAGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313601    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026998.3-1638s21c1
Sequence:CCGGTATCTGTGTAAAGCGTCTTAACTCGAGTTAAGACGCTTTACACAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026998.3-663s21c1
Sequence:CCGGAGAGTATCACAACCGAGTTAACTCGAGTTAACTCGGTTGTGATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026998.3-458s21c1
Sequence:CCGGGGGTTGCAGCGCATCCTATTTCTCGAGAAATAGGATGCGCTGCAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026998.3-155s21c1
Sequence:CCGGCCGTTCACACAAAGAGTTCATCTCGAGATGAACTCTTTGTGTGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026998.2-1469s1c1
Sequence:CCGGCCTGTCTTACTGTGTTTATTTCTCGAGAAATAAACACAGTAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026998.2-59s1c1
Sequence:CCGGCGCGGACTTAAAGCAATAAATCTCGAGATTTATTGCTTTAAGTCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026998.2-156s1c1
Sequence:CCGGCCGTTCACACAAAGAGTTCATCTCGAGATGAACTCTTTGTGTGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026998.2-1151s1c1
Sequence:CCGGGCAGAACTAGAACTGAAGCATCTCGAGATGCTTCAGTTCTAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026998.2-1039s1c1
Sequence:CCGGCCAACAGTTGTGCTGTCAGAACTCGAGTTCTGACAGCACAACTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks