EMAIL THIS PAGE TO A FRIEND

SNX7

sorting nexin 7

Gene ID:
Human(51375) Summary: This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region like some family members, and its exact function is unknown. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 11. [provided by RefSeq, Jun 2010]
Mouse(76561) sorting nexin 7
Rat(310815) sorting nexin 7
Zebrafish(431776) sorting nexin 7
domestic cat(101080813) sorting nexin 7
dog(490148) sorting nexin 7
chicken(424478) sorting nexin 7
naked mole-rat(101713693) sorting nexin 7
Domestic Rabbit(100349417) sorting nexin 7
cow(512918) sorting nexin 7
sheep(101109840) sorting nexin 7
122 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015976 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015976 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015976 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029655 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029655 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029655 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015976 Rosetta Predictions human pricing
NM_152238 Rosetta Predictions human pricing
NM_001012083 Rosetta Predictions rat pricing
XM_575027 Rosetta Predictions rat pricing
NM_029655 Rosetta Predictions mouse pricing
XM_001005105 Rosetta Predictions mouse pricing
XM_131162 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015976 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130581 predicted 920
2 SASI_Hs01_00130582 predicted 769
3 SASI_Hs01_00130583 predicted 612
4 SASI_Hs01_00130584 predicted 579
5 SASI_Hs01_00130585 predicted 602
6 SASI_Hs01_00130586 predicted 776
7 SASI_Hs01_00130587 predicted 725
8 SASI_Hs01_00130588 predicted 588
9 SASI_Hs01_00130589 predicted 695
10 SASI_Hs01_00130590 predicted 708
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028951 predicted 840
2 SASI_Hs01_00028952 predicted 690
3 SASI_Hs01_00028953 predicted 535
4 SASI_Hs01_00028954 predicted 501
5 SASI_Hs01_00028955 predicted 524
6 SASI_Hs01_00028956 predicted 686
7 SASI_Hs01_00028957 predicted 644
8 SASI_Hs01_00028958 predicted 495
9 SASI_Hs01_00028959 predicted 613
10 SASI_Hs01_00028960 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012083 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076075 predicted 216
2 SASI_Rn01_00076076 predicted 836
3 SASI_Rn01_00076077 predicted 415
4 SASI_Rn01_00076078 predicted 349
5 SASI_Rn01_00076079 predicted 1257
6 SASI_Rn01_00076080 predicted 988
7 SASI_Rn01_00076081 predicted 1317
8 SASI_Rn01_00076082 predicted 1271
9 SASI_Rn01_00076083 predicted 1298
10 SASI_Rn02_00200213 predicted 530
11 SASI_Rn01_00076084 predicted 889
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575027 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00136886 predicted 561
2 SASI_Rn01_00136887 predicted 1182
3 SASI_Rn01_00136888 predicted 760
4 SASI_Rn01_00136889 predicted 693
5 SASI_Rn01_00136890 predicted 1605
6 SASI_Rn01_00136891 predicted 1334
7 SASI_Rn01_00136892 predicted 1617
8 SASI_Rn01_00136893 predicted 1502
9 SASI_Rn01_00136894 predicted 1646
10 SASI_Rn01_00136895 predicted 1231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029655 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335674 predicted 721
2 SASI_Mm02_00335675 predicted 506
3 SASI_Mm02_00335676 predicted 206
4 SASI_Mm02_00335677 predicted 886
5 SASI_Mm02_00335678 predicted 246
6 SASI_Mm02_00335679 predicted 797
7 SASI_Mm02_00335680 predicted 291
8 SASI_Mm02_00335681 predicted 898
9 SASI_Mm02_00335682 predicted 995
10 SASI_Mm02_00335683 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001005105 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246445 predicted 523
2 SASI_Mm01_00246446 predicted 877
3 SASI_Mm01_00246447 predicted 658
4 SASI_Mm01_00246448 predicted 358
5 SASI_Mm01_00246449 predicted 392
6 SASI_Mm01_00246450 predicted 601
7 SASI_Mm01_00246451 predicted 443
8 SASI_Mm01_00246452 predicted 600
9 SASI_Mm01_00246453 predicted 524
10 SASI_Mm01_00246454 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_131162 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231553 predicted 875
2 SASI_Mm01_00231554 predicted 654
3 SASI_Mm01_00231555 predicted 354
4 SASI_Mm01_00231556 predicted 1035
5 SASI_Mm01_00231557 predicted 1066
6 SASI_Mm01_00231558 predicted 445
7 SASI_Mm01_00231559 predicted 1082
8 SASI_Mm01_00231560 predicted 1041
9 SASI_Mm01_00231561 predicted 1137
10 SASI_Mm01_00231562 predicted 417
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015976
VALIDATED
SNX7 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015976.2-785s1c1
Sequence:CCGGCGTCCTCAATGAGAGGAGTTACTCGAGTAACTCCTCTCATTGAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015976.2-941s1c1
Sequence:CCGGGCCCAATTCATATTCTGTGGTCTCGAGACCACAGAATATGAATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015976.2-533s1c1
Sequence:CCGGCCACTCTGATTATTCCACCATCTCGAGATGGTGGAATAATCAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160597    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015976.2-1479s1c1
Sequence:CCGGCCAAAGTTATTCTTTCTGGATCTCGAGATCCAGAAAGAATAACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015976.2-968s1c1
Sequence:CCGGCAGAAGAGGATCTGGTTGATACTCGAGTATCAACCAGATCCTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015976.3-626s21c1
Sequence:CCGGATTGCTGATCATCCAACTTTACTCGAGTAAAGTTGGATGATCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015976.3-945s21c1
Sequence:CCGGCAGAAGAGGATCTGGTTGATACTCGAGTATCAACCAGATCCTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015976.3-1303s21c1
Sequence:CCGGTGAGGAGAATATCCATTATTACTCGAGTAATAATGGATATTCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015976.3-1456s21c1
Sequence:CCGGCCAAAGTTATTCTTTCTGGATCTCGAGATCCAGAAAGAATAACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015976.3-553s21c1
Sequence:CCGGAGGAATGGTGGAACGCTTTAACTCGAGTTAAAGCGTTCCACCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015976
VALIDATED
SNX7 MISSION shRNA shRNA Plasmid DNA
sorting nexin 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015976.2-785s1c1
Sequence:CCGGCGTCCTCAATGAGAGGAGTTACTCGAGTAACTCCTCTCATTGAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015976.2-941s1c1
Sequence:CCGGGCCCAATTCATATTCTGTGGTCTCGAGACCACAGAATATGAATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015976.2-533s1c1
Sequence:CCGGCCACTCTGATTATTCCACCATCTCGAGATGGTGGAATAATCAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160597    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015976.2-1479s1c1
Sequence:CCGGCCAAAGTTATTCTTTCTGGATCTCGAGATCCAGAAAGAATAACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015976.2-968s1c1
Sequence:CCGGCAGAAGAGGATCTGGTTGATACTCGAGTATCAACCAGATCCTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015976.3-626s21c1
Sequence:CCGGATTGCTGATCATCCAACTTTACTCGAGTAAAGTTGGATGATCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015976.3-945s21c1
Sequence:CCGGCAGAAGAGGATCTGGTTGATACTCGAGTATCAACCAGATCCTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015976.3-1303s21c1
Sequence:CCGGTGAGGAGAATATCCATTATTACTCGAGTAATAATGGATATTCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015976.3-1456s21c1
Sequence:CCGGCCAAAGTTATTCTTTCTGGATCTCGAGATCCAGAAAGAATAACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015976.3-553s21c1
Sequence:CCGGAGGAATGGTGGAACGCTTTAACTCGAGTTAAAGCGTTCCACCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015976
VALIDATED
SNX7 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015976.2-785s1c1
Sequence:CCGGCGTCCTCAATGAGAGGAGTTACTCGAGTAACTCCTCTCATTGAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015976.2-941s1c1
Sequence:CCGGGCCCAATTCATATTCTGTGGTCTCGAGACCACAGAATATGAATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015976.2-533s1c1
Sequence:CCGGCCACTCTGATTATTCCACCATCTCGAGATGGTGGAATAATCAGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160597    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015976.2-1479s1c1
Sequence:CCGGCCAAAGTTATTCTTTCTGGATCTCGAGATCCAGAAAGAATAACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015976.2-968s1c1
Sequence:CCGGCAGAAGAGGATCTGGTTGATACTCGAGTATCAACCAGATCCTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015976.3-626s21c1
Sequence:CCGGATTGCTGATCATCCAACTTTACTCGAGTAAAGTTGGATGATCAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015976.3-945s21c1
Sequence:CCGGCAGAAGAGGATCTGGTTGATACTCGAGTATCAACCAGATCCTCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015976.3-1303s21c1
Sequence:CCGGTGAGGAGAATATCCATTATTACTCGAGTAATAATGGATATTCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015976.3-1456s21c1
Sequence:CCGGCCAAAGTTATTCTTTCTGGATCTCGAGATCCAGAAAGAATAACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015976.3-553s21c1
Sequence:CCGGAGGAATGGTGGAACGCTTTAACTCGAGTTAAAGCGTTCCACCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029655
VALIDATED
SNX7 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029655.2-266s21c1
Sequence:CCGGTTGAAGTCAGGCGACGTTATCCTCGAGGATAACGTCGCCTGACTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253175    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029655.2-1387s21c1
Sequence:CCGGCAACGTGAATTTGTGATATAACTCGAGTTATATCACAAATTCACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029655.2-113s21c1
Sequence:CCGGTGATAAACCAGATCAAGTTTGCTCGAGCAAACTTGATCTGGTTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029655.2-445s21c1
Sequence:CCGGATCGCTGACCATCCCACTTTACTCGAGTAAAGTGGGATGGTCAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029655.2-1153s21c1
Sequence:CCGGCTTGCAACATGGGAATCATTCCTCGAGGAATGATTCCCATGTTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029655
VALIDATED
SNX7 MISSION shRNA shRNA Plasmid DNA
sorting nexin 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029655.2-266s21c1
Sequence:CCGGTTGAAGTCAGGCGACGTTATCCTCGAGGATAACGTCGCCTGACTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253175    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029655.2-1387s21c1
Sequence:CCGGCAACGTGAATTTGTGATATAACTCGAGTTATATCACAAATTCACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029655.2-113s21c1
Sequence:CCGGTGATAAACCAGATCAAGTTTGCTCGAGCAAACTTGATCTGGTTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029655.2-445s21c1
Sequence:CCGGATCGCTGACCATCCCACTTTACTCGAGTAAAGTGGGATGGTCAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029655.2-1153s21c1
Sequence:CCGGCTTGCAACATGGGAATCATTCCTCGAGGAATGATTCCCATGTTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029655
VALIDATED
SNX7 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029655.2-266s21c1
Sequence:CCGGTTGAAGTCAGGCGACGTTATCCTCGAGGATAACGTCGCCTGACTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253175    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029655.2-1387s21c1
Sequence:CCGGCAACGTGAATTTGTGATATAACTCGAGTTATATCACAAATTCACGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029655.2-113s21c1
Sequence:CCGGTGATAAACCAGATCAAGTTTGCTCGAGCAAACTTGATCTGGTTTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029655.2-445s21c1
Sequence:CCGGATCGCTGACCATCCCACTTTACTCGAGTAAAGTGGGATGGTCAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029655.2-1153s21c1
Sequence:CCGGCTTGCAACATGGGAATCATTCCTCGAGGAATGATTCCCATGTTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks