EMAIL THIS PAGE TO A FRIEND

SNX8

sorting nexin 8

Synonyms: Mvp1
UniProtKB ID: Q9Y5X2, A4D207, Q96I67
Gene ID:
Mouse(231834) sorting nexin 8
Rat(288504) sorting nexin 8
cow(614344) sorting nexin 8
sheep(101113123) sorting nexin 8
naked mole-rat(101713184) sorting nexin 8
Zebrafish(387289) sorting nexin 8
Horse(100059657) sorting nexin 8
domestic cat(101091328) sorting nexin 8
dog(479767) sorting nexin 8
chicken(416468) sorting nexin 8
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172277 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172277 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172277 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013321 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013321 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013321 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013321 Rosetta Predictions human pricing
NM_001105912 Rosetta Predictions rat pricing
NM_172277 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013321 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029700 predicted 582
2 SASI_Hs01_00029701 predicted 362
3 SASI_Hs01_00029703 predicted 356
4 SASI_Hs01_00029704 predicted 341
5 SASI_Hs01_00029705 predicted 666
6 SASI_Hs01_00029706 predicted 1086
7 SASI_Hs01_00029707 predicted 727
8 SASI_Hs01_00029708 predicted 817
9 SASI_Hs01_00029709 predicted 586
10 SASI_Hs02_00344624 predicted 449
11 SASI_Hs01_00029702 predicted 904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105912 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213762 predicted 1169
2 SASI_Rn02_00213763 predicted 1167
3 SASI_Rn02_00213764 predicted 944
4 SASI_Rn02_00213765 predicted 798
5 SASI_Rn02_00213766 predicted 746
6 SASI_Rn02_00213767 predicted 1140
7 SASI_Rn02_00213768 predicted 297
8 SASI_Rn02_00213769 predicted 331
9 SASI_Rn02_00213770 predicted 1349
10 SASI_Rn02_00213771 predicted 683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172277 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136183 predicted 915
2 SASI_Mm01_00136184 predicted 1498
3 SASI_Mm01_00136185 predicted 1137
4 SASI_Mm01_00136186 predicted 721
5 SASI_Mm01_00136187 predicted 622
6 SASI_Mm01_00136188 predicted 1282
7 SASI_Mm01_00136189 predicted 289
8 SASI_Mm01_00136190 predicted 1503
9 SASI_Mm01_00136191 predicted 1599
10 SASI_Mm01_00136192 predicted 308
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172277
VALIDATED
SNX8 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 8
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172277.2-1126s21c1
Sequence:GTACCGGGAGAACGTGATCCAGACTATGCTCGAGCATAGTCTGGATCACGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172277.2-1858s21c1
Sequence:GTACCGGGAGCTTTGGAGGACATCTTTCCTCGAGGAAAGATGTCCTCCAAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172277.2-652s21c1
Sequence:GTACCGGAGCCGGGAGCTGATTCGAAATCTCGAGATTTCGAATCAGCTCCCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172277.2-737s21c1
Sequence:GTACCGGACGCTGCTGATCTTCTCATATCTCGAGATATGAGAAGATCAGCAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105940    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172277.1-2213s1c1
Sequence:CCGGCCTGACTCCAAACTTGAGGTTCTCGAGAACCTCAAGTTTGGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172277.1-981s1c1
Sequence:CCGGGATTTGTTGCAGTCCTACAAACTCGAGTTTGTAGGACTGCAACAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172277.1-651s1c1
Sequence:CCGGGCTGACATCCAGACTCAATTTCTCGAGAAATTGAGTCTGGATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172277.1-765s1c1
Sequence:CCGGGCTGCTGATCTTCTCATATTTCTCGAGAAATATGAGAAGATCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172277.1-1163s1c1
Sequence:CCGGCCAGACTATGGAACTCCGAAACTCGAGTTTCGGAGTTCCATAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172277
VALIDATED
SNX8 MISSION shRNA shRNA Plasmid DNA
sorting nexin 8
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172277.2-1126s21c1
Sequence:GTACCGGGAGAACGTGATCCAGACTATGCTCGAGCATAGTCTGGATCACGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172277.2-1858s21c1
Sequence:GTACCGGGAGCTTTGGAGGACATCTTTCCTCGAGGAAAGATGTCCTCCAAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172277.2-652s21c1
Sequence:GTACCGGAGCCGGGAGCTGATTCGAAATCTCGAGATTTCGAATCAGCTCCCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172277.2-737s21c1
Sequence:GTACCGGACGCTGCTGATCTTCTCATATCTCGAGATATGAGAAGATCAGCAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105940    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172277.1-2213s1c1
Sequence:CCGGCCTGACTCCAAACTTGAGGTTCTCGAGAACCTCAAGTTTGGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172277.1-981s1c1
Sequence:CCGGGATTTGTTGCAGTCCTACAAACTCGAGTTTGTAGGACTGCAACAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172277.1-651s1c1
Sequence:CCGGGCTGACATCCAGACTCAATTTCTCGAGAAATTGAGTCTGGATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172277.1-765s1c1
Sequence:CCGGGCTGCTGATCTTCTCATATTTCTCGAGAAATATGAGAAGATCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172277.1-1163s1c1
Sequence:CCGGCCAGACTATGGAACTCCGAAACTCGAGTTTCGGAGTTCCATAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172277
VALIDATED
SNX8 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 8
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172277.2-1126s21c1
Sequence:GTACCGGGAGAACGTGATCCAGACTATGCTCGAGCATAGTCTGGATCACGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379599    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172277.2-1858s21c1
Sequence:GTACCGGGAGCTTTGGAGGACATCTTTCCTCGAGGAAAGATGTCCTCCAAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172277.2-652s21c1
Sequence:GTACCGGAGCCGGGAGCTGATTCGAAATCTCGAGATTTCGAATCAGCTCCCGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172277.2-737s21c1
Sequence:GTACCGGACGCTGCTGATCTTCTCATATCTCGAGATATGAGAAGATCAGCAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105940    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172277.1-2213s1c1
Sequence:CCGGCCTGACTCCAAACTTGAGGTTCTCGAGAACCTCAAGTTTGGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172277.1-981s1c1
Sequence:CCGGGATTTGTTGCAGTCCTACAAACTCGAGTTTGTAGGACTGCAACAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172277.1-651s1c1
Sequence:CCGGGCTGACATCCAGACTCAATTTCTCGAGAAATTGAGTCTGGATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172277.1-765s1c1
Sequence:CCGGGCTGCTGATCTTCTCATATTTCTCGAGAAATATGAGAAGATCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172277.1-1163s1c1
Sequence:CCGGCCAGACTATGGAACTCCGAAACTCGAGTTTCGGAGTTCCATAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013321
VALIDATED
SNX8 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 8
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000342961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013321.1-582s21c1
Sequence:CCGGCGGATGTGCAGAACAAGTTAACTCGAGTTAACTTGTTCTGCACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013321.1-1294s21c1
Sequence:CCGGCTTCGTCAACTCTCAGATCCACTCGAGTGGATCTGAGAGTTGACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013321.1-820s21c1
Sequence:CCGGGCTAAGTGCAATAGGGTCTGACTCGAGTCAGACCCTATTGCACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013321.1-713s21c1
Sequence:CCGGCTGATCCGGAACATCTACAATCTCGAGATTGTAGATGTTCCGGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_013321.1-1294s1c1
Sequence:CCGGCTTCGTCAACTCTCAGATCCACTCGAGTGGATCTGAGAGTTGACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013321.1-820s1c1
Sequence:CCGGGCTAAGTGCAATAGGGTCTGACTCGAGTCAGACCCTATTGCACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_013321.1-1081s1c1
Sequence:CCGGGCACAAGTACAGCCTGATGAACTCGAGTTCATCAGGCTGTACTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013321.1-803s1c1
Sequence:CCGGCTCATATTCGGGAAGGAGCTACTCGAGTAGCTCCTTCCCGAATATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013321.1-307s1c1
Sequence:CCGGCTTCCTGAAGCATGTGGAGTACTCGAGTACTCCACATGCTTCAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013321.1-364s1c1
Sequence:CCGGCAGACGGTACAATGACTTCGTCTCGAGACGAAGTCATTGTACCGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_013321.1-713s1c1
Sequence:CCGGCTGATCCGGAACATCTACAATCTCGAGATTGTAGATGTTCCGGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_013321.1-582s1c1
Sequence:CCGGCGGATGTGCAGAACAAGTTAACTCGAGTTAACTTGTTCTGCACATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_013321.1-590s1c1
Sequence:CCGGCAGAACAAGTTAAAGGAGTCACTCGAGTGACTCCTTTAACTTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013321
VALIDATED
SNX8 MISSION shRNA shRNA Plasmid DNA
sorting nexin 8
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000342961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013321.1-582s21c1
Sequence:CCGGCGGATGTGCAGAACAAGTTAACTCGAGTTAACTTGTTCTGCACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013321.1-1294s21c1
Sequence:CCGGCTTCGTCAACTCTCAGATCCACTCGAGTGGATCTGAGAGTTGACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013321.1-820s21c1
Sequence:CCGGGCTAAGTGCAATAGGGTCTGACTCGAGTCAGACCCTATTGCACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013321.1-713s21c1
Sequence:CCGGCTGATCCGGAACATCTACAATCTCGAGATTGTAGATGTTCCGGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_013321.1-1294s1c1
Sequence:CCGGCTTCGTCAACTCTCAGATCCACTCGAGTGGATCTGAGAGTTGACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013321.1-820s1c1
Sequence:CCGGGCTAAGTGCAATAGGGTCTGACTCGAGTCAGACCCTATTGCACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_013321.1-1081s1c1
Sequence:CCGGGCACAAGTACAGCCTGATGAACTCGAGTTCATCAGGCTGTACTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013321.1-803s1c1
Sequence:CCGGCTCATATTCGGGAAGGAGCTACTCGAGTAGCTCCTTCCCGAATATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013321.1-307s1c1
Sequence:CCGGCTTCCTGAAGCATGTGGAGTACTCGAGTACTCCACATGCTTCAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013321.1-364s1c1
Sequence:CCGGCAGACGGTACAATGACTTCGTCTCGAGACGAAGTCATTGTACCGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_013321.1-713s1c1
Sequence:CCGGCTGATCCGGAACATCTACAATCTCGAGATTGTAGATGTTCCGGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_013321.1-582s1c1
Sequence:CCGGCGGATGTGCAGAACAAGTTAACTCGAGTTAACTTGTTCTGCACATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_013321.1-590s1c1
Sequence:CCGGCAGAACAAGTTAAAGGAGTCACTCGAGTGACTCCTTTAACTTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013321
VALIDATED
SNX8 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 8
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000342961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013321.1-582s21c1
Sequence:CCGGCGGATGTGCAGAACAAGTTAACTCGAGTTAACTTGTTCTGCACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013321.1-1294s21c1
Sequence:CCGGCTTCGTCAACTCTCAGATCCACTCGAGTGGATCTGAGAGTTGACGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013321.1-820s21c1
Sequence:CCGGGCTAAGTGCAATAGGGTCTGACTCGAGTCAGACCCTATTGCACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013321.1-713s21c1
Sequence:CCGGCTGATCCGGAACATCTACAATCTCGAGATTGTAGATGTTCCGGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_013321.1-1294s1c1
Sequence:CCGGCTTCGTCAACTCTCAGATCCACTCGAGTGGATCTGAGAGTTGACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013321.1-820s1c1
Sequence:CCGGGCTAAGTGCAATAGGGTCTGACTCGAGTCAGACCCTATTGCACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_013321.1-1081s1c1
Sequence:CCGGGCACAAGTACAGCCTGATGAACTCGAGTTCATCAGGCTGTACTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013321.1-803s1c1
Sequence:CCGGCTCATATTCGGGAAGGAGCTACTCGAGTAGCTCCTTCCCGAATATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013321.1-307s1c1
Sequence:CCGGCTTCCTGAAGCATGTGGAGTACTCGAGTACTCCACATGCTTCAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_013321.1-364s1c1
Sequence:CCGGCAGACGGTACAATGACTTCGTCTCGAGACGAAGTCATTGTACCGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_013321.1-713s1c1
Sequence:CCGGCTGATCCGGAACATCTACAATCTCGAGATTGTAGATGTTCCGGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_013321.1-582s1c1
Sequence:CCGGCGGATGTGCAGAACAAGTTAACTCGAGTTAACTTGTTCTGCACATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_013321.1-590s1c1
Sequence:CCGGCAGAACAAGTTAAAGGAGTCACTCGAGTGACTCCTTTAACTTGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks