EMAIL THIS PAGE TO A FRIEND

SNX9

sorting nexin 9

Synonyms: SDP1 SH3PX1 SH3PXD3A WISP
UniProtKB ID: Q9Y5X1, Q9BSI7, Q9BVM1, Q9UJH6, Q9UP20
Gene ID:
Human(51429) Summary: This gene encodes a member of the sorting nexin family. Members of this family contain a phosphoinositide binding domain, and are involved in intracellular trafficking. The encoded protein does not contain a coiled coil region, like some family members, but does contain a SRC homology domain near its N-terminus. The encoded protein is reported to have a variety of interaction partners, including of adaptor protein 2 , dynamin, tyrosine kinase non-receptor 2, Wiskott-Aldrich syndrome-like, and ARP3 actin-related protein 3. The encoded protein is implicated in several stages of intracellular trafficking, including endocytosis, macropinocytosis, and F-actin nucleation. [provided by RefSeq, Jul 2013]
Mouse(66616) sorting nexin 9
Rat(683687) sorting nexin 9
chicken(421654) sorting nexin 9
dog(476254) sorting nexin 9
domestic cat(101091537) sorting nexin 9
Horse(100059877) sorting nexin 9
naked mole-rat(101701892) sorting nexin 9
cow(506218) sorting nexin 9
sheep(101109101) sorting nexin 9
117 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016224 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016224 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016224 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025664 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025664 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025664 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU080111 MISSION® esiRNA esiRNA targeting mouse Snx9 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016224 Rosetta Predictions human pricing
NM_001127637 Rosetta Predictions rat pricing
NM_025664 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016224 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059667 predicted 1808
2 SASI_Hs01_00059669 predicted 970
3 SASI_Hs01_00059670 predicted 1634
4 SASI_Hs02_00349081 predicted 1728
5 SASI_Hs01_00059671 predicted 965
6 SASI_Hs02_00349082 predicted 577
7 SASI_Hs01_00059673 predicted 1678
8 SASI_Hs02_00349083 predicted 1616
9 SASI_Hs01_00059675 predicted 1494
10 SASI_Hs02_00349084 predicted 1691
11 SASI_Hs01_00059666 predicted 893
12 SASI_Hs01_00059668 predicted 1545
13 SASI_Hs01_00059672 predicted 999
14 SASI_Hs01_00059674 predicted 996
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127637 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254700 predicted 757
2 SASI_Rn02_00254701 predicted 864
3 SASI_Rn02_00254702 predicted 846
4 SASI_Rn02_00254703 predicted 1584
5 SASI_Rn02_00254704 predicted 978
6 SASI_Rn02_00254705 predicted 950
7 SASI_Rn02_00254706 predicted 1004
8 SASI_Rn02_00254707 predicted 1657
9 SASI_Rn02_00254708 predicted 960
10 SASI_Rn02_00254709 predicted 1794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025664 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328801 predicted 845
2 SASI_Mm01_00046974 predicted 1527
3 SASI_Mm01_00046975 predicted 980
4 SASI_Mm01_00046976 predicted 1015
5 SASI_Mm01_00046977 predicted 221
6 SASI_Mm01_00046978 predicted 766
7 SASI_Mm01_00046979 predicted 218
8 SASI_Mm01_00046980 predicted 1593
9 SASI_Mm01_00046981 predicted 629
10 SASI_Mm01_00046982 predicted 898
11 SASI_Mm01_00046973 predicted 853
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016224
VALIDATED
SNX9 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 9
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016224.3-1192s1c1
Sequence:CCGGGCCATCCAGTAATCTCAGAAACTCGAGTTTCTGAGATTACTGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016224.3-1640s1c1
Sequence:CCGGGATGGAATGTAATCACGAGTACTCGAGTACTCGTGATTACATTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_016224.3-1818s1c1
Sequence:CCGGCAAGCTGAGATGAATCACTTTCTCGAGAAAGTGATTCATCTCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016224.3-784s1c1
Sequence:CCGGCCCTTAACAAATTTCCTGGATCTCGAGATCCAGGAAATTTGTTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016224.3-992s1c1
Sequence:CCGGGCTAACACCTACTAACACTAACTCGAGTTAGTGTTAGTAGGTGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016224.3-2149s21c1
Sequence:CCGGTCATTTCCGCATCCATTATTTCTCGAGAAATAATGGATGCGGAAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016224.3-888s21c1
Sequence:CCGGTATGGCCCAATGTGGGTTTATCTCGAGATAAACCCACATTGGGCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016224.3-1185s21c1
Sequence:CCGGATGTGTCGCCATCCAGTAATCCTCGAGGATTACTGGATGGCGACACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016224.3-1124s21c1
Sequence:CCGGCCGCTTTGAAGAGGAATTTATCTCGAGATAAATTCCTCTTCAAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016224.3-1036s21c1
Sequence:CCGGAGCACTTTGACTGGTTATATGCTCGAGCATATAACCAGTCAAAGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016224.3-223s21c1
Sequence:CCGGATAATGAACTGACGGTTAATGCTCGAGCATTAACCGTCAGTTCATTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016224.3-969s21c1
Sequence:CCGGCTAAAGAGCTACATCGAATATCTCGAGATATTCGATGTAGCTCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016224
VALIDATED
SNX9 MISSION shRNA shRNA Plasmid DNA
sorting nexin 9
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016224.3-1192s1c1
Sequence:CCGGGCCATCCAGTAATCTCAGAAACTCGAGTTTCTGAGATTACTGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016224.3-1640s1c1
Sequence:CCGGGATGGAATGTAATCACGAGTACTCGAGTACTCGTGATTACATTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_016224.3-1818s1c1
Sequence:CCGGCAAGCTGAGATGAATCACTTTCTCGAGAAAGTGATTCATCTCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016224.3-784s1c1
Sequence:CCGGCCCTTAACAAATTTCCTGGATCTCGAGATCCAGGAAATTTGTTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016224.3-992s1c1
Sequence:CCGGGCTAACACCTACTAACACTAACTCGAGTTAGTGTTAGTAGGTGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016224.3-2149s21c1
Sequence:CCGGTCATTTCCGCATCCATTATTTCTCGAGAAATAATGGATGCGGAAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016224.3-888s21c1
Sequence:CCGGTATGGCCCAATGTGGGTTTATCTCGAGATAAACCCACATTGGGCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016224.3-1185s21c1
Sequence:CCGGATGTGTCGCCATCCAGTAATCCTCGAGGATTACTGGATGGCGACACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016224.3-1124s21c1
Sequence:CCGGCCGCTTTGAAGAGGAATTTATCTCGAGATAAATTCCTCTTCAAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016224.3-1036s21c1
Sequence:CCGGAGCACTTTGACTGGTTATATGCTCGAGCATATAACCAGTCAAAGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016224.3-223s21c1
Sequence:CCGGATAATGAACTGACGGTTAATGCTCGAGCATTAACCGTCAGTTCATTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016224.3-969s21c1
Sequence:CCGGCTAAAGAGCTACATCGAATATCTCGAGATATTCGATGTAGCTCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016224
VALIDATED
SNX9 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 9
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016224.3-1192s1c1
Sequence:CCGGGCCATCCAGTAATCTCAGAAACTCGAGTTTCTGAGATTACTGGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016224.3-1640s1c1
Sequence:CCGGGATGGAATGTAATCACGAGTACTCGAGTACTCGTGATTACATTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_016224.3-1818s1c1
Sequence:CCGGCAAGCTGAGATGAATCACTTTCTCGAGAAAGTGATTCATCTCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016224.3-784s1c1
Sequence:CCGGCCCTTAACAAATTTCCTGGATCTCGAGATCCAGGAAATTTGTTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016224.3-992s1c1
Sequence:CCGGGCTAACACCTACTAACACTAACTCGAGTTAGTGTTAGTAGGTGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016224.3-2149s21c1
Sequence:CCGGTCATTTCCGCATCCATTATTTCTCGAGAAATAATGGATGCGGAAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016224.3-888s21c1
Sequence:CCGGTATGGCCCAATGTGGGTTTATCTCGAGATAAACCCACATTGGGCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016224.3-1185s21c1
Sequence:CCGGATGTGTCGCCATCCAGTAATCCTCGAGGATTACTGGATGGCGACACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016224.3-1124s21c1
Sequence:CCGGCCGCTTTGAAGAGGAATTTATCTCGAGATAAATTCCTCTTCAAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016224.3-1036s21c1
Sequence:CCGGAGCACTTTGACTGGTTATATGCTCGAGCATATAACCAGTCAAAGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016224.3-223s21c1
Sequence:CCGGATAATGAACTGACGGTTAATGCTCGAGCATTAACCGTCAGTTCATTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016224.3-969s21c1
Sequence:CCGGCTAAAGAGCTACATCGAATATCTCGAGATATTCGATGTAGCTCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025664
VALIDATED
SNX9 MISSION shRNA Bacterial Glycerol Stock
sorting nexin 9
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025664.2-860s1c1
Sequence:CCGGCGTTGGAGATTATGGCCCTATCTCGAGATAGGGCCATAATCTCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025664.2-996s1c1
Sequence:CCGGCGATCTGTAAACCACAGATATCTCGAGATATCTGTGGTTTACAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025664.2-1008s1c1
Sequence:CCGGCACAGATATAAGCACTTTGATCTCGAGATCAAAGTGCTTATATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025664.2-1317s1c1
Sequence:CCGGCCTGACTTGGATTTGATAGAACTCGAGTTCTATCAAATCCAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025664.2-312s1c1
Sequence:CCGGCCTACTGACTACGTGGAAATTCTCGAGAATTTCCACGTAGTCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025664.5-312s21c1
Sequence:CCGGCCTACTGACTACGTGGAAATTCTCGAGAATTTCCACGTAGTCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025664.5-996s21c1
Sequence:CCGGCGATCTGTAAACCACAGATATCTCGAGATATCTGTGGTTTACAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025664.5-1008s21c1
Sequence:CCGGCACAGATATAAGCACTTTGATCTCGAGATCAAAGTGCTTATATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025664.5-1317s21c1
Sequence:CCGGCCTGACTTGGATTTGATAGAACTCGAGTTCTATCAAATCCAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025664.5-1795s21c1
Sequence:GTACCGGCTCTGCAAGCTGAGATGAATCCTCGAGGATTCATCTCAGCTTGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025664.5-1819s21c1
Sequence:GTACCGGTTCACAGTAACCGGATCTATGCTCGAGCATAGATCCGGTTACTGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025664
VALIDATED
SNX9 MISSION shRNA shRNA Plasmid DNA
sorting nexin 9
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025664.2-860s1c1
Sequence:CCGGCGTTGGAGATTATGGCCCTATCTCGAGATAGGGCCATAATCTCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025664.2-996s1c1
Sequence:CCGGCGATCTGTAAACCACAGATATCTCGAGATATCTGTGGTTTACAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025664.2-1008s1c1
Sequence:CCGGCACAGATATAAGCACTTTGATCTCGAGATCAAAGTGCTTATATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025664.2-1317s1c1
Sequence:CCGGCCTGACTTGGATTTGATAGAACTCGAGTTCTATCAAATCCAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025664.2-312s1c1
Sequence:CCGGCCTACTGACTACGTGGAAATTCTCGAGAATTTCCACGTAGTCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025664.5-312s21c1
Sequence:CCGGCCTACTGACTACGTGGAAATTCTCGAGAATTTCCACGTAGTCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025664.5-996s21c1
Sequence:CCGGCGATCTGTAAACCACAGATATCTCGAGATATCTGTGGTTTACAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025664.5-1008s21c1
Sequence:CCGGCACAGATATAAGCACTTTGATCTCGAGATCAAAGTGCTTATATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025664.5-1317s21c1
Sequence:CCGGCCTGACTTGGATTTGATAGAACTCGAGTTCTATCAAATCCAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025664.5-1795s21c1
Sequence:GTACCGGCTCTGCAAGCTGAGATGAATCCTCGAGGATTCATCTCAGCTTGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025664.5-1819s21c1
Sequence:GTACCGGTTCACAGTAACCGGATCTATGCTCGAGCATAGATCCGGTTACTGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025664
VALIDATED
SNX9 MISSION shRNA Lentiviral Transduction Particles
sorting nexin 9
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025664.2-860s1c1
Sequence:CCGGCGTTGGAGATTATGGCCCTATCTCGAGATAGGGCCATAATCTCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025664.2-996s1c1
Sequence:CCGGCGATCTGTAAACCACAGATATCTCGAGATATCTGTGGTTTACAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025664.2-1008s1c1
Sequence:CCGGCACAGATATAAGCACTTTGATCTCGAGATCAAAGTGCTTATATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025664.2-1317s1c1
Sequence:CCGGCCTGACTTGGATTTGATAGAACTCGAGTTCTATCAAATCCAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025664.2-312s1c1
Sequence:CCGGCCTACTGACTACGTGGAAATTCTCGAGAATTTCCACGTAGTCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025664.5-312s21c1
Sequence:CCGGCCTACTGACTACGTGGAAATTCTCGAGAATTTCCACGTAGTCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025664.5-996s21c1
Sequence:CCGGCGATCTGTAAACCACAGATATCTCGAGATATCTGTGGTTTACAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025664.5-1008s21c1
Sequence:CCGGCACAGATATAAGCACTTTGATCTCGAGATCAAAGTGCTTATATCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025664.5-1317s21c1
Sequence:CCGGCCTGACTTGGATTTGATAGAACTCGAGTTCTATCAAATCCAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025664.5-1795s21c1
Sequence:GTACCGGCTCTGCAAGCTGAGATGAATCCTCGAGGATTCATCTCAGCTTGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025664.5-1819s21c1
Sequence:GTACCGGTTCACAGTAACCGGATCTATGCTCGAGCATAGATCCGGTTACTGTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks