EMAIL THIS PAGE TO A FRIEND

SOAT1

sterol O-acyltransferase 1

Synonyms: ACACT ACAT ACAT-1 ACAT1 SOAT STAT
Gene ID:
Human(6646) Summary: The protein encoded by this gene belongs to the acyltransferase family. It is located in the endoplasmic reticulum, and catalyzes the formation of fatty acid-cholesterol esters. This gene has been implicated in the formation of beta-amyloid and atherosclerotic plaques by controlling the equilibrium between free cholesterol and cytoplasmic cholesteryl esters. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2011]
Mouse(20652) sterol O-acyltransferase 1
Rat(81782) sterol O-acyltransferase 1
cow(504287) sterol O-acyltransferase 1
sheep(101121363) sterol O-acyltransferase 1
naked mole-rat(101725301) sterol O-acyltransferase 1
domestic guinea pig(100716750) sterol O-acyltransferase 1
Zebrafish(564424) sterol O-acyltransferase 1
chicken(424424) sterol O-acyltransferase 1
dog(490325) sterol O-acyltransferase 1
domestic cat(101081271) sterol O-acyltransferase 1
123 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA047171 Anti-SOAT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2106708 Anti-SOAT1 antibody produced in rabbit affinity isolated antibody human, horse, rabbit, guinea pig
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009230 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009230 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009230 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003101 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003101 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003101 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003101 Rosetta Predictions human pricing
NM_031118 Rosetta Predictions rat pricing
NM_009230 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003101 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126484 predicted 1285
2 SASI_Hs01_00126485 predicted 1789
3 SASI_Hs01_00126486 predicted 1549
4 SASI_Hs01_00126487 predicted 1385
5 SASI_Hs01_00126488 predicted 1434
6 SASI_Hs01_00126490 predicted 906
7 SASI_Hs01_00126491 predicted 1224
8 SASI_Hs01_00126492 predicted 1760
9 SASI_Hs01_00126493 predicted 1398
10 SASI_Hs02_00335061 predicted 1416
11 SASI_Hs01_00126489 predicted 946
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031118 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056743 predicted 1233
2 SASI_Rn01_00056744 predicted 887
3 SASI_Rn01_00056745 predicted 852
4 SASI_Rn01_00056747 predicted 1259
5 SASI_Rn01_00056748 predicted 641
6 SASI_Rn01_00056749 predicted 875
7 SASI_Rn01_00056750 predicted 870
8 SASI_Rn02_00264423 predicted 1501
9 SASI_Rn01_00056751 predicted 275
10 SASI_Rn01_00056752 predicted 1350
11 SASI_Rn01_00056746 predicted 1245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009230 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315676 predicted 1086
2 SASI_Mm02_00315677 predicted 709
3 SASI_Mm02_00315678 predicted 1037
4 SASI_Mm02_00315679 predicted 1080
5 SASI_Mm02_00315680 predicted 817
6 SASI_Mm02_00315681 predicted 1689
7 SASI_Mm02_00315682 predicted 315
8 SASI_Mm02_00315683 predicted 300
9 SASI_Mm02_00315684 predicted 572
10 SASI_Mm02_00315685 predicted 1343
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009230
VALIDATED
SOAT1 MISSION shRNA Bacterial Glycerol Stock
sterol O-acyltransferase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353388    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009230.3-2928s21c1
Sequence:CCGGGCGTAGTGACTTTCCTTGTTACTCGAGTAACAAGGAAAGTCACTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009230.3-819s21c1
Sequence:CCGGGTTCTCACCCATTGATCTATTCTCGAGAATAGATCAATGGGTGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336269    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009230.3-2133s21c1
Sequence:CCGGCCAACCAGAGACTAAACATATCTCGAGATATGTTTAGTCTCTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009230.3-2899s21c1
Sequence:CCGGCCTTTGGTCTAATTGCTTTATCTCGAGATAAAGCAATTAGACCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009230.3-1000s21c1
Sequence:CCGGGAATATCCCACGAGTACTAAACTCGAGTTTAGTACTCGTGGGATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197536    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009230.1-2731s1c1
Sequence:CCGGCCAACCAGAGACTAAACATATCTCGAGATATGTTTAGTCTCTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197396    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009230.1-3496s1c1
Sequence:CCGGCCTTTGGTCTAATTGCTTTATCTCGAGATAAAGCAATTAGACCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178477    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009230.1-3525s1c1
Sequence:CCGGGCGTAGTGACTTTCCTTGTTACTCGAGTAACAAGGAAAGTCACTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009230.1-2268s1c1
Sequence:CCGGCCAATCTGGAACATCATGGTTCTCGAGAACCATGATGTTCCAGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009230
VALIDATED
SOAT1 MISSION shRNA shRNA Plasmid DNA
sterol O-acyltransferase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353388    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009230.3-2928s21c1
Sequence:CCGGGCGTAGTGACTTTCCTTGTTACTCGAGTAACAAGGAAAGTCACTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009230.3-819s21c1
Sequence:CCGGGTTCTCACCCATTGATCTATTCTCGAGAATAGATCAATGGGTGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336269    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009230.3-2133s21c1
Sequence:CCGGCCAACCAGAGACTAAACATATCTCGAGATATGTTTAGTCTCTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009230.3-2899s21c1
Sequence:CCGGCCTTTGGTCTAATTGCTTTATCTCGAGATAAAGCAATTAGACCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009230.3-1000s21c1
Sequence:CCGGGAATATCCCACGAGTACTAAACTCGAGTTTAGTACTCGTGGGATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197536    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009230.1-2731s1c1
Sequence:CCGGCCAACCAGAGACTAAACATATCTCGAGATATGTTTAGTCTCTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197396    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009230.1-3496s1c1
Sequence:CCGGCCTTTGGTCTAATTGCTTTATCTCGAGATAAAGCAATTAGACCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178477    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009230.1-3525s1c1
Sequence:CCGGGCGTAGTGACTTTCCTTGTTACTCGAGTAACAAGGAAAGTCACTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009230.1-2268s1c1
Sequence:CCGGCCAATCTGGAACATCATGGTTCTCGAGAACCATGATGTTCCAGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009230
VALIDATED
SOAT1 MISSION shRNA Lentiviral Transduction Particles
sterol O-acyltransferase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353388    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009230.3-2928s21c1
Sequence:CCGGGCGTAGTGACTTTCCTTGTTACTCGAGTAACAAGGAAAGTCACTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009230.3-819s21c1
Sequence:CCGGGTTCTCACCCATTGATCTATTCTCGAGAATAGATCAATGGGTGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336269    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009230.3-2133s21c1
Sequence:CCGGCCAACCAGAGACTAAACATATCTCGAGATATGTTTAGTCTCTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009230.3-2899s21c1
Sequence:CCGGCCTTTGGTCTAATTGCTTTATCTCGAGATAAAGCAATTAGACCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009230.3-1000s21c1
Sequence:CCGGGAATATCCCACGAGTACTAAACTCGAGTTTAGTACTCGTGGGATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197536    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009230.1-2731s1c1
Sequence:CCGGCCAACCAGAGACTAAACATATCTCGAGATATGTTTAGTCTCTGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197396    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009230.1-3496s1c1
Sequence:CCGGCCTTTGGTCTAATTGCTTTATCTCGAGATAAAGCAATTAGACCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178477    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009230.1-3525s1c1
Sequence:CCGGGCGTAGTGACTTTCCTTGTTACTCGAGTAACAAGGAAAGTCACTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009230.1-2268s1c1
Sequence:CCGGCCAATCTGGAACATCATGGTTCTCGAGAACCATGATGTTCCAGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003101
VALIDATED
SOAT1 MISSION shRNA Bacterial Glycerol Stock
sterol O-acyltransferase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234515    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003101.4-2688s21c1
Sequence:CCGGTAATCACCTCCACTCATATTACTCGAGTAATATGAGTGGAGGTGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003101.4-1331s21c1
Sequence:CCGGTGGTCCATGACTGGCTATATTCTCGAGAATATAGCCAGTCATGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003101.4-1292s21c1
Sequence:CCGGCCACGTCATACTCCAACTATTCTCGAGAATAGTTGGAGTATGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003101.4-882s21c1
Sequence:CCGGGAACGTGCCTCGGGTACTAAACTCGAGTTTAGTACCCGAGGCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003101.4-176s21c1
Sequence:CCGGGTAATGGTCGAATTGACATAACTCGAGTTATGTCAATTCGACCATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003101.3-1739s1c1
Sequence:CCGGCCTCCAGAACAAGGAAAGATTCTCGAGAATCTTTCCTTGTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003101.3-1568s1c1
Sequence:CCGGGCAGAGGAATTGAAGCCATTTCTCGAGAAATGGCTTCAATTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003101.3-2625s1c1
Sequence:CCGGCCACGTCATACTCCAACTATTCTCGAGAATAGTTGGAGTATGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_003101.3-2378s1c1
Sequence:CCGGGCACAGGTCTTTGGTTGCTTTCTCGAGAAAGCAACCAAAGACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003101.3-2884s1c1
Sequence:CCGGGCCGATTTGGAATGTTCTGATCTCGAGATCAGAACATTCCAAATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003101
VALIDATED
SOAT1 MISSION shRNA shRNA Plasmid DNA
sterol O-acyltransferase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234515    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003101.4-2688s21c1
Sequence:CCGGTAATCACCTCCACTCATATTACTCGAGTAATATGAGTGGAGGTGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003101.4-1331s21c1
Sequence:CCGGTGGTCCATGACTGGCTATATTCTCGAGAATATAGCCAGTCATGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003101.4-1292s21c1
Sequence:CCGGCCACGTCATACTCCAACTATTCTCGAGAATAGTTGGAGTATGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003101.4-882s21c1
Sequence:CCGGGAACGTGCCTCGGGTACTAAACTCGAGTTTAGTACCCGAGGCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003101.4-176s21c1
Sequence:CCGGGTAATGGTCGAATTGACATAACTCGAGTTATGTCAATTCGACCATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003101.3-1739s1c1
Sequence:CCGGCCTCCAGAACAAGGAAAGATTCTCGAGAATCTTTCCTTGTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003101.3-1568s1c1
Sequence:CCGGGCAGAGGAATTGAAGCCATTTCTCGAGAAATGGCTTCAATTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003101.3-2625s1c1
Sequence:CCGGCCACGTCATACTCCAACTATTCTCGAGAATAGTTGGAGTATGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_003101.3-2378s1c1
Sequence:CCGGGCACAGGTCTTTGGTTGCTTTCTCGAGAAAGCAACCAAAGACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003101.3-2884s1c1
Sequence:CCGGGCCGATTTGGAATGTTCTGATCTCGAGATCAGAACATTCCAAATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003101
VALIDATED
SOAT1 MISSION shRNA Lentiviral Transduction Particles
sterol O-acyltransferase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234515    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003101.4-2688s21c1
Sequence:CCGGTAATCACCTCCACTCATATTACTCGAGTAATATGAGTGGAGGTGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003101.4-1331s21c1
Sequence:CCGGTGGTCCATGACTGGCTATATTCTCGAGAATATAGCCAGTCATGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003101.4-1292s21c1
Sequence:CCGGCCACGTCATACTCCAACTATTCTCGAGAATAGTTGGAGTATGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003101.4-882s21c1
Sequence:CCGGGAACGTGCCTCGGGTACTAAACTCGAGTTTAGTACCCGAGGCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003101.4-176s21c1
Sequence:CCGGGTAATGGTCGAATTGACATAACTCGAGTTATGTCAATTCGACCATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003101.3-1739s1c1
Sequence:CCGGCCTCCAGAACAAGGAAAGATTCTCGAGAATCTTTCCTTGTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003101.3-1568s1c1
Sequence:CCGGGCAGAGGAATTGAAGCCATTTCTCGAGAAATGGCTTCAATTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003101.3-2625s1c1
Sequence:CCGGCCACGTCATACTCCAACTATTCTCGAGAATAGTTGGAGTATGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_003101.3-2378s1c1
Sequence:CCGGGCACAGGTCTTTGGTTGCTTTCTCGAGAAAGCAACCAAAGACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003101.3-2884s1c1
Sequence:CCGGGCCGATTTGGAATGTTCTGATCTCGAGATCAGAACATTCCAAATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks