EMAIL THIS PAGE TO A FRIEND

SOAT2

sterol O-acyltransferase 2

Synonyms: ACACT2 ACAT2 ARGP2
UniProtKB ID: O75908, Q4VB99, Q96TD4, Q9UNR2
Gene ID:
Mouse(223920) sterol O-acyltransferase 2
Rat(266770) sterol O-acyltransferase 2
dog(486511) sterol O-acyltransferase 2
Horse(100146367) sterol O-acyltransferase 2
domestic cat(101099223) sterol O-acyltransferase 2
domestic guinea pig(100728450) sterol O-acyltransferase 2
naked mole-rat(101718579) sterol O-acyltransferase 2
Domestic Rabbit(100349393) sterol O-acyltransferase 2
cow(513554) sterol O-acyltransferase 2
sheep(101107179) sterol O-acyltransferase 2
99 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003578 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003578 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003578 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011433 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011433 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011433 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_146064 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146064 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146064 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003578 Rosetta Predictions human pricing
NM_153728 Rosetta Predictions rat pricing
NM_146064 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003578 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158375 predicted 298
2 SASI_Hs01_00158377 predicted 1432
3 SASI_Hs01_00158378 predicted 1629
4 SASI_Hs01_00158379 predicted 769
5 SASI_Hs01_00158376 predicted 1688
6 SASI_Hs01_00158381 predicted 1687
7 SASI_Hs01_00158380 predicted 1265
8 SASI_Hs01_00158382 predicted 950
9 SASI_Hs01_00158383 predicted 1443
10 SASI_Hs02_00335892 predicted 1188
11 SASI_Hs01_00158374 predicted 919
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153728 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269022 predicted 1434
2 SASI_Rn01_00118374 predicted 1158
3 SASI_Rn01_00118375 predicted 518
4 SASI_Rn01_00118376 predicted 542
5 SASI_Rn01_00118377 predicted 763
6 SASI_Rn01_00118378 predicted 627
7 SASI_Rn01_00118379 predicted 709
8 SASI_Rn01_00118381 predicted 1112
9 SASI_Rn01_00118382 predicted 1712
10 SASI_Rn01_00118383 predicted 440
11 SASI_Rn01_00118380 predicted 1121
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146064 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077011 predicted 496
2 SASI_Mm01_00077012 predicted 408
3 SASI_Mm01_00077013 predicted 546
4 SASI_Mm01_00077014 predicted 502
5 SASI_Mm01_00077015 predicted 321
6 SASI_Mm01_00077017 predicted 393
7 SASI_Mm01_00077018 predicted 893
8 SASI_Mm01_00077019 predicted 388
9 SASI_Mm01_00077020 predicted 945
10 SASI_Mm02_00341682 predicted 331
11 SASI_Mm01_00077016 predicted 224
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003578
SOAT2 MISSION shRNA Bacterial Glycerol Stock
sterol O-acyltransferase 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003578.2-918s1c1
Sequence:CCGGGCCCTATGTCAGGTGGAATTACTCGAGTAATTCCACCTGACATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003578.2-1350s1c1
Sequence:CCGGCCATGAGTATATCTTCTGCTTCTCGAGAAGCAGAAGATATACTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003578.2-756s1c1
Sequence:CCGGGCAGGTTAGGTTCCTGATGAACTCGAGTTCATCAGGAACCTAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003578.2-260s1c1
Sequence:CCGGAGGCTATACAATCCTACCCATCTCGAGATGGGTAGGATTGTATAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003578.2-1158s1c1
Sequence:CCGGGCTACGATTTGGAGACAGGATCTCGAGATCCTGTCTCCAAATCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003578.3-1856s21c1
Sequence:CCGGGACCAGGGTGACTCTTCAATCCTCGAGGATTGAAGAGTCACCCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003578.3-223s21c1
Sequence:CCGGGGAGGCTGTGAAGGCACAATTCTCGAGAATTGTGCCTTCACAGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003578.3-926s21c1
Sequence:CCGGCTCATCTACAGGGAGACTTACCTCGAGGTAAGTCTCCCTGTAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003578.3-1290s21c1
Sequence:CCGGGGCTGTACAGCTACGTGTATCCTCGAGGATACACGTAGCTGTACAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003578
SOAT2 MISSION shRNA shRNA Plasmid DNA
sterol O-acyltransferase 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003578.2-918s1c1
Sequence:CCGGGCCCTATGTCAGGTGGAATTACTCGAGTAATTCCACCTGACATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003578.2-1350s1c1
Sequence:CCGGCCATGAGTATATCTTCTGCTTCTCGAGAAGCAGAAGATATACTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003578.2-756s1c1
Sequence:CCGGGCAGGTTAGGTTCCTGATGAACTCGAGTTCATCAGGAACCTAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003578.2-260s1c1
Sequence:CCGGAGGCTATACAATCCTACCCATCTCGAGATGGGTAGGATTGTATAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003578.2-1158s1c1
Sequence:CCGGGCTACGATTTGGAGACAGGATCTCGAGATCCTGTCTCCAAATCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003578.3-1856s21c1
Sequence:CCGGGACCAGGGTGACTCTTCAATCCTCGAGGATTGAAGAGTCACCCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003578.3-223s21c1
Sequence:CCGGGGAGGCTGTGAAGGCACAATTCTCGAGAATTGTGCCTTCACAGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003578.3-926s21c1
Sequence:CCGGCTCATCTACAGGGAGACTTACCTCGAGGTAAGTCTCCCTGTAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003578.3-1290s21c1
Sequence:CCGGGGCTGTACAGCTACGTGTATCCTCGAGGATACACGTAGCTGTACAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003578
SOAT2 MISSION shRNA Lentiviral Transduction Particles
sterol O-acyltransferase 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003578.2-918s1c1
Sequence:CCGGGCCCTATGTCAGGTGGAATTACTCGAGTAATTCCACCTGACATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003578.2-1350s1c1
Sequence:CCGGCCATGAGTATATCTTCTGCTTCTCGAGAAGCAGAAGATATACTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003578.2-756s1c1
Sequence:CCGGGCAGGTTAGGTTCCTGATGAACTCGAGTTCATCAGGAACCTAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003578.2-260s1c1
Sequence:CCGGAGGCTATACAATCCTACCCATCTCGAGATGGGTAGGATTGTATAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003578.2-1158s1c1
Sequence:CCGGGCTACGATTTGGAGACAGGATCTCGAGATCCTGTCTCCAAATCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003578.3-1856s21c1
Sequence:CCGGGACCAGGGTGACTCTTCAATCCTCGAGGATTGAAGAGTCACCCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003578.3-223s21c1
Sequence:CCGGGGAGGCTGTGAAGGCACAATTCTCGAGAATTGTGCCTTCACAGCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003578.3-926s21c1
Sequence:CCGGCTCATCTACAGGGAGACTTACCTCGAGGTAAGTCTCCCTGTAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003578.3-1290s21c1
Sequence:CCGGGGCTGTACAGCTACGTGTATCCTCGAGGATACACGTAGCTGTACAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011433
SOAT2 MISSION shRNA Bacterial Glycerol Stock
sterol O-acyltransferase 2
Mouse
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000175668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011433.1-377s1c1
Sequence:CCGGGCAACATTTCCGAACCATCTACTCGAGTAGATGGTTCGGAAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011433
SOAT2 MISSION shRNA shRNA Plasmid DNA
sterol O-acyltransferase 2
Mouse
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000175668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011433.1-377s1c1
Sequence:CCGGGCAACATTTCCGAACCATCTACTCGAGTAGATGGTTCGGAAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011433
SOAT2 MISSION shRNA Lentiviral Transduction Particles
sterol O-acyltransferase 2
Mouse
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000175668    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011433.1-377s1c1
Sequence:CCGGGCAACATTTCCGAACCATCTACTCGAGTAGATGGTTCGGAAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146064
SOAT2 MISSION shRNA Bacterial Glycerol Stock
sterol O-acyltransferase 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146064.1-380s1c1
Sequence:CCGGGTCACTGATCGATGAGCTAATCTCGAGATTAGCTCATCGATCAGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146064.1-890s21c1
Sequence:CCGGCCTCTTCTGCCCTACACTTATCTCGAGATAAGTGTAGGGCAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146064.1-170s21c1
Sequence:CCGGGGTGCAATGGACTCGACATATCTCGAGATATGTCGAGTCCATTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146064.1-1358s21c1
Sequence:CCGGTGCGGTGGTTCATGAGTATATCTCGAGATATACTCATGAACCACCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146064.1-1934s21c1
Sequence:CCGGGCTTCTCCCAATGCAACAATACTCGAGTATTGTTGCATTGGGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146064.1-395s21c1
Sequence:CCGGGCTAATGGAGGTGCAACATTTCTCGAGAAATGTTGCACCTCCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146064
SOAT2 MISSION shRNA shRNA Plasmid DNA
sterol O-acyltransferase 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146064.1-380s1c1
Sequence:CCGGGTCACTGATCGATGAGCTAATCTCGAGATTAGCTCATCGATCAGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146064.1-890s21c1
Sequence:CCGGCCTCTTCTGCCCTACACTTATCTCGAGATAAGTGTAGGGCAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146064.1-170s21c1
Sequence:CCGGGGTGCAATGGACTCGACATATCTCGAGATATGTCGAGTCCATTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146064.1-1358s21c1
Sequence:CCGGTGCGGTGGTTCATGAGTATATCTCGAGATATACTCATGAACCACCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146064.1-1934s21c1
Sequence:CCGGGCTTCTCCCAATGCAACAATACTCGAGTATTGTTGCATTGGGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146064.1-395s21c1
Sequence:CCGGGCTAATGGAGGTGCAACATTTCTCGAGAAATGTTGCACCTCCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146064
SOAT2 MISSION shRNA Lentiviral Transduction Particles
sterol O-acyltransferase 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216844    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146064.1-380s1c1
Sequence:CCGGGTCACTGATCGATGAGCTAATCTCGAGATTAGCTCATCGATCAGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146064.1-890s21c1
Sequence:CCGGCCTCTTCTGCCCTACACTTATCTCGAGATAAGTGTAGGGCAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146064.1-170s21c1
Sequence:CCGGGGTGCAATGGACTCGACATATCTCGAGATATGTCGAGTCCATTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146064.1-1358s21c1
Sequence:CCGGTGCGGTGGTTCATGAGTATATCTCGAGATATACTCATGAACCACCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146064.1-1934s21c1
Sequence:CCGGGCTTCTCCCAATGCAACAATACTCGAGTATTGTTGCATTGGGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146064.1-395s21c1
Sequence:CCGGGCTAATGGAGGTGCAACATTTCTCGAGAAATGTTGCACCTCCATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks