EMAIL THIS PAGE TO A FRIEND

SOBP

sine oculis binding protein homolog (Drosophila)

Synonyms: JXC1 MRAMS
UniProtKB ID: A7XYQ1, B0QZ12, Q5BJD4, Q8N2B2
Gene ID:
Human(55084) Summary: The protein encoded by this gene is a nuclear zinc finger protein that is involved in development of the cochlea. Defects in this gene have also been linked to intellectual disability. [provided by RefSeq, Mar 2011]
Mouse(109205) sine oculis-binding protein homolog (Drosophila)
Rat(309860) sine oculis-binding protein homolog (Drosophila)
fruit fly(36260) Sine oculis-binding protein
domestic cat(101097398) sine oculis binding protein homolog (Drosophila)
Horse(100072075) sine oculis binding protein homolog (Drosophila)
dog(612126) sine oculis binding protein homolog (Drosophila)
chicken(421775) sine oculis binding protein homolog (Drosophila)
cow(537433) sine oculis binding protein homolog (Drosophila)
sheep(101108923) sine oculis binding protein homolog (Drosophila)
naked mole-rat(101702938) sine oculis binding protein homolog (Drosophila)
domestic guinea pig(100728118) sine oculis binding protein homolog (Drosophila)
100 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018013 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018013 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018013 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175407 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175407 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175407 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018013 Rosetta Predictions human pricing
NM_001104640 Rosetta Predictions rat pricing
NM_175407 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018013 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221383 predicted 1398
2 SASI_Hs01_00221384 predicted 870
3 SASI_Hs01_00221385 predicted 1174
4 SASI_Hs02_00351112 predicted 1241
5 SASI_Hs01_00221386 predicted 1163
6 SASI_Hs01_00221388 predicted 673
7 SASI_Hs02_00351113 predicted 1065
8 SASI_Hs01_00221389 predicted 799
9 SASI_Hs01_00221390 predicted 1139
10 SASI_Hs01_00221391 predicted 913
11 SASI_Hs01_00221382 predicted 1968
12 SASI_Hs01_00221387 predicted 909
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001104640 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211706 predicted 368
2 SASI_Rn02_00211707 predicted 897
3 SASI_Rn02_00211708 predicted 649
4 SASI_Rn02_00211709 predicted 660
5 SASI_Rn02_00211710 predicted 644
6 SASI_Rn02_00211711 predicted 2363
7 SASI_Rn02_00211712 predicted 266
8 SASI_Rn02_00211713 predicted 195
9 SASI_Rn02_00211714 predicted 678
10 SASI_Rn02_00211715 predicted 434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175407 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346274 predicted 3023
2 SASI_Mm02_00346275 predicted 830
3 SASI_Mm01_00083106 predicted 1356
4 SASI_Mm02_00346276 predicted 887
5 SASI_Mm02_00346277 predicted 1098
6 SASI_Mm02_00346278 predicted 724
7 SASI_Mm01_00083112 predicted 899
8 SASI_Mm01_00083113 predicted 655
9 SASI_Mm02_00346279 predicted 1131
10 SASI_Mm02_00346280 predicted 877
11 SASI_Mm01_00083105 predicted 1512
12 SASI_Mm01_00083107 predicted 713
13 SASI_Mm01_00083108 predicted 508
14 SASI_Mm01_00083109 predicted 411
15 SASI_Mm01_00083110 predicted 2408
16 SASI_Mm01_00083111 predicted 1194
17 SASI_Mm01_00083114 predicted 504
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018013
VALIDATED
SOBP MISSION shRNA Bacterial Glycerol Stock
sine oculis binding protein homolog (Drosophila)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018013.3-3439s21c1
Sequence:CCGGACAAGGACCAATGTAGGTATTCTCGAGAATACCTACATTGGTCCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018013.3-1402s21c1
Sequence:CCGGTGGAATATCCCGCTAACAGATCTCGAGATCTGTTAGCGGGATATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018013.3-972s21c1
Sequence:CCGGAGTGGGAATCAAGCGCTATTCCTCGAGGAATAGCGCTTGATTCCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018013.3-792s21c1
Sequence:CCGGCAATATAAGCACAGGCTATTCCTCGAGGAATAGCCTGTGCTTATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018013.3-864s1c1
Sequence:CCGGTCATGGCAGTGTGCCCATTATCTCGAGATAATGGGCACACTGCCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018013.3-644s1c1
Sequence:CCGGGCTATGATAAGGTTGAATTAACTCGAGTTAATTCAACCTTATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018013.3-765s21c1
Sequence:CCGGACCCGAGGACAGTGTTATTTCCTCGAGGAAATAACACTGTCCTCGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018013.3-1183s21c1
Sequence:CCGGTGGTGTAAGCACATAAGACACCTCGAGGTGTCTTATGTGCTTACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018013.1-774s1c1
Sequence:CCGGGAGGTGCCTCCGAATTAGAAACTCGAGTTTCTAATTCGGAGGCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018013.1-266s1c1
Sequence:CCGGCAGTGAGCATGATGCCAAATGCTCGAGCATTTGGCATCATGCTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167050    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018013.2-3357s1c1
Sequence:CCGGCCTGTCATGGTTAAGAGAAATCTCGAGATTTCTCTTAACCATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018013
VALIDATED
SOBP MISSION shRNA shRNA Plasmid DNA
sine oculis binding protein homolog (Drosophila)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018013.3-3439s21c1
Sequence:CCGGACAAGGACCAATGTAGGTATTCTCGAGAATACCTACATTGGTCCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018013.3-1402s21c1
Sequence:CCGGTGGAATATCCCGCTAACAGATCTCGAGATCTGTTAGCGGGATATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018013.3-972s21c1
Sequence:CCGGAGTGGGAATCAAGCGCTATTCCTCGAGGAATAGCGCTTGATTCCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018013.3-792s21c1
Sequence:CCGGCAATATAAGCACAGGCTATTCCTCGAGGAATAGCCTGTGCTTATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018013.3-864s1c1
Sequence:CCGGTCATGGCAGTGTGCCCATTATCTCGAGATAATGGGCACACTGCCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018013.3-644s1c1
Sequence:CCGGGCTATGATAAGGTTGAATTAACTCGAGTTAATTCAACCTTATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018013.3-765s21c1
Sequence:CCGGACCCGAGGACAGTGTTATTTCCTCGAGGAAATAACACTGTCCTCGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018013.3-1183s21c1
Sequence:CCGGTGGTGTAAGCACATAAGACACCTCGAGGTGTCTTATGTGCTTACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018013.1-774s1c1
Sequence:CCGGGAGGTGCCTCCGAATTAGAAACTCGAGTTTCTAATTCGGAGGCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018013.1-266s1c1
Sequence:CCGGCAGTGAGCATGATGCCAAATGCTCGAGCATTTGGCATCATGCTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167050    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018013.2-3357s1c1
Sequence:CCGGCCTGTCATGGTTAAGAGAAATCTCGAGATTTCTCTTAACCATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018013
VALIDATED
SOBP MISSION shRNA Lentiviral Transduction Particles
sine oculis binding protein homolog (Drosophila)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434130    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018013.3-3439s21c1
Sequence:CCGGACAAGGACCAATGTAGGTATTCTCGAGAATACCTACATTGGTCCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018013.3-1402s21c1
Sequence:CCGGTGGAATATCCCGCTAACAGATCTCGAGATCTGTTAGCGGGATATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018013.3-972s21c1
Sequence:CCGGAGTGGGAATCAAGCGCTATTCCTCGAGGAATAGCGCTTGATTCCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018013.3-792s21c1
Sequence:CCGGCAATATAAGCACAGGCTATTCCTCGAGGAATAGCCTGTGCTTATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018013.3-864s1c1
Sequence:CCGGTCATGGCAGTGTGCCCATTATCTCGAGATAATGGGCACACTGCCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018013.3-644s1c1
Sequence:CCGGGCTATGATAAGGTTGAATTAACTCGAGTTAATTCAACCTTATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018013.3-765s21c1
Sequence:CCGGACCCGAGGACAGTGTTATTTCCTCGAGGAAATAACACTGTCCTCGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018013.3-1183s21c1
Sequence:CCGGTGGTGTAAGCACATAAGACACCTCGAGGTGTCTTATGTGCTTACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018013.1-774s1c1
Sequence:CCGGGAGGTGCCTCCGAATTAGAAACTCGAGTTTCTAATTCGGAGGCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172427    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018013.1-266s1c1
Sequence:CCGGCAGTGAGCATGATGCCAAATGCTCGAGCATTTGGCATCATGCTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167050    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018013.2-3357s1c1
Sequence:CCGGCCTGTCATGGTTAAGAGAAATCTCGAGATTTCTCTTAACCATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175407
VALIDATED
SOBP MISSION shRNA Bacterial Glycerol Stock
sine oculis binding protein homolog (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_175407.3-3833s1c1
Sequence:CCGGTGCCAAGAGAACTCGGTAAATCTCGAGATTTACCGAGTTCTCTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175407.3-819s1c1
Sequence:CCGGCCATGGCAATGTGCCTATTATCTCGAGATAATAGGCACATTGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175407.3-588s1c1
Sequence:CCGGTGGCTGGTATGGCTATGATAACTCGAGTTATCATAGCCATACCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_175407.2-401s1c1
Sequence:CCGGCGGAGGACAGTGTTATTTCATCTCGAGATGAAATAACACTGTCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175407.2-879s1c1
Sequence:CCGGCCACCCTCACATGGAAAGTAACTCGAGTTACTTTCCATGTGAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175407
VALIDATED
SOBP MISSION shRNA shRNA Plasmid DNA
sine oculis binding protein homolog (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_175407.3-3833s1c1
Sequence:CCGGTGCCAAGAGAACTCGGTAAATCTCGAGATTTACCGAGTTCTCTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175407.3-819s1c1
Sequence:CCGGCCATGGCAATGTGCCTATTATCTCGAGATAATAGGCACATTGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175407.3-588s1c1
Sequence:CCGGTGGCTGGTATGGCTATGATAACTCGAGTTATCATAGCCATACCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_175407.2-401s1c1
Sequence:CCGGCGGAGGACAGTGTTATTTCATCTCGAGATGAAATAACACTGTCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175407.2-879s1c1
Sequence:CCGGCCACCCTCACATGGAAAGTAACTCGAGTTACTTTCCATGTGAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175407
VALIDATED
SOBP MISSION shRNA Lentiviral Transduction Particles
sine oculis binding protein homolog (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_175407.3-3833s1c1
Sequence:CCGGTGCCAAGAGAACTCGGTAAATCTCGAGATTTACCGAGTTCTCTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175407.3-819s1c1
Sequence:CCGGCCATGGCAATGTGCCTATTATCTCGAGATAATAGGCACATTGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175407.3-588s1c1
Sequence:CCGGTGGCTGGTATGGCTATGATAACTCGAGTTATCATAGCCATACCAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_175407.2-401s1c1
Sequence:CCGGCGGAGGACAGTGTTATTTCATCTCGAGATGAAATAACACTGTCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175407.2-879s1c1
Sequence:CCGGCCACCCTCACATGGAAAGTAACTCGAGTTACTTTCCATGTGAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks