EMAIL THIS PAGE TO A FRIEND

SOCS1

suppressor of cytokine signaling 1

Synonyms: CIS1 CISH1 JAB SOCS-1 SSI-1 SSI1 TIP3
UniProtKB ID: O15524, O15097, Q9NSA7
Gene ID:
Human(8651) Summary: This gene encodes a member of the STAT-induced STAT inhibitor (SSI), also known as suppressor of cytokine signaling (SOCS), family. SSI family members are cytokine-inducible negative regulators of cytokine signaling. The expression of this gene can be induced by a subset of cytokines, including IL2, IL3 erythropoietin (EPO), CSF2/GM-CSF, and interferon (IFN)-gamma. The protein encoded by this gene functions downstream of cytokine receptors, and takes part in a negative feedback loop to attenuate cytokine signaling. Knockout studies in mice suggested the role of this gene as a modulator of IFN-gamma action, which is required for normal postnatal growth and survival. [provided by RefSeq, Jul 2008]
Mouse(12703) suppressor of cytokine signaling 1
Rat(252971) suppressor of cytokine signaling 1
chicken(416630) suppressor of cytokine signaling 1
dog(490006) suppressor of cytokine signaling 1
cow(518795) suppressor of cytokine signaling 1
sheep(101107324) suppressor of cytokine signaling 1
domestic guinea pig(100728652) suppressor of cytokine signaling 1
naked mole-rat(101729320) suppressor of cytokine signaling 1
102 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009896 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009896 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009896 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003745 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003745 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003745 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU203261 MISSION® esiRNA esiRNA targeting mouse Socs1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003745 Rosetta Predictions human pricing
NM_145879 Rosetta Predictions rat pricing
NM_009896 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003745 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093418 predicted 796
2 SASI_Hs02_00336204 predicted 793
3 SASI_Hs01_00093419 predicted 748
4 SASI_Hs02_00336205 predicted 798
5 SASI_Hs01_00093420 predicted 809
6 SASI_Hs01_00093421 predicted 712
7 SASI_Hs01_00093423 predicted 521
8 SASI_Hs02_00336206 predicted 810
9 SASI_Hs01_00093427 predicted 536
10 SASI_Hs02_00336207 predicted 792
11 SASI_Hs01_00093422 predicted 529
12 SASI_Hs01_00093424 predicted 558
13 SASI_Hs01_00093425 predicted 518
14 SASI_Hs01_00093426 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145879 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041744 predicted 367
2 SASI_Rn01_00041745 predicted 375
3 SASI_Rn01_00041746 predicted 401
4 SASI_Rn01_00041747 predicted 413
5 SASI_Rn01_00041748 predicted 395
6 SASI_Rn01_00041749 predicted 312
7 SASI_Rn01_00041750 predicted 602
8 SASI_Rn01_00041751 predicted 586
9 SASI_Rn01_00041752 predicted 550
10 SASI_Rn01_00041753 predicted 572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009896 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047370 predicted 464
2 SASI_Mm01_00047371 predicted 471
3 SASI_Mm01_00047372 predicted 556
4 SASI_Mm01_00047373 predicted 578
5 SASI_Mm01_00047374 predicted 302
6 SASI_Mm01_00047375 predicted 376
7 SASI_Mm01_00047377 predicted 476
8 SASI_Mm01_00047378 predicted 376
9 SASI_Mm02_00317399 predicted 320
10 SASI_Mm01_00047379 predicted 324
11 SASI_Mm01_00047376 predicted 533
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009896
VALIDATED
SOCS1 MISSION shRNA Bacterial Glycerol Stock
suppressor of cytokine signaling 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009896.1-285s1c1
Sequence:CCGGCGACACTCACTTCCGCACCTTCTCGAGAAGGTGCGGAAGTGAGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009896.1-554s1c1
Sequence:CCGGGCGAGACCTTCGACTGCCTTTCTCGAGAAAGGCAGTCGAAGGTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009896.1-441s1c1
Sequence:CCGGGCGCGACAGTCGCCAACGGAACTCGAGTTCCGTTGGCGACTGTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009896.1-732s1c1
Sequence:CCGGCCGTGACTACCTGAGTTCCTTCTCGAGAAGGAACTCAGGTAGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009896.1-709s1c1
Sequence:CCGGCGCATCCCTCTTAACCCGGTACTCGAGTACCGGGTTAAGAGGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009896.2-380s21c1
Sequence:CCGGTGGACGCCTGCGGCTTCTATTCTCGAGAATAGAAGCCGCAGGCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009896.2-747s21c1
Sequence:CCGGTAACCCGGTACTCCGTGACTACTCGAGTAGTCACGGAGTACCGGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009896.2-829s21c1
Sequence:CCGGGCGCCTTATTATTTCTTATTACTCGAGTAATAAGAAATAATAAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009896.2-477s21c1
Sequence:CCGGTCGCCAACGGAACTGCTTCTTCTCGAGAAGAAGCAGTTCCGTTGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009896.2-331s21c1
Sequence:CCGGTTCCGCTCCCACTCCGATTACCTCGAGGTAATCGGAGTGGGAGCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009896
VALIDATED
SOCS1 MISSION shRNA shRNA Plasmid DNA
suppressor of cytokine signaling 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009896.1-285s1c1
Sequence:CCGGCGACACTCACTTCCGCACCTTCTCGAGAAGGTGCGGAAGTGAGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009896.1-554s1c1
Sequence:CCGGGCGAGACCTTCGACTGCCTTTCTCGAGAAAGGCAGTCGAAGGTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009896.1-441s1c1
Sequence:CCGGGCGCGACAGTCGCCAACGGAACTCGAGTTCCGTTGGCGACTGTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009896.1-732s1c1
Sequence:CCGGCCGTGACTACCTGAGTTCCTTCTCGAGAAGGAACTCAGGTAGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009896.1-709s1c1
Sequence:CCGGCGCATCCCTCTTAACCCGGTACTCGAGTACCGGGTTAAGAGGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009896.2-380s21c1
Sequence:CCGGTGGACGCCTGCGGCTTCTATTCTCGAGAATAGAAGCCGCAGGCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009896.2-747s21c1
Sequence:CCGGTAACCCGGTACTCCGTGACTACTCGAGTAGTCACGGAGTACCGGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009896.2-829s21c1
Sequence:CCGGGCGCCTTATTATTTCTTATTACTCGAGTAATAAGAAATAATAAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009896.2-477s21c1
Sequence:CCGGTCGCCAACGGAACTGCTTCTTCTCGAGAAGAAGCAGTTCCGTTGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009896.2-331s21c1
Sequence:CCGGTTCCGCTCCCACTCCGATTACCTCGAGGTAATCGGAGTGGGAGCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009896
VALIDATED
SOCS1 MISSION shRNA Lentiviral Transduction Particles
suppressor of cytokine signaling 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009896.1-285s1c1
Sequence:CCGGCGACACTCACTTCCGCACCTTCTCGAGAAGGTGCGGAAGTGAGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009896.1-554s1c1
Sequence:CCGGGCGAGACCTTCGACTGCCTTTCTCGAGAAAGGCAGTCGAAGGTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009896.1-441s1c1
Sequence:CCGGGCGCGACAGTCGCCAACGGAACTCGAGTTCCGTTGGCGACTGTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009896.1-732s1c1
Sequence:CCGGCCGTGACTACCTGAGTTCCTTCTCGAGAAGGAACTCAGGTAGTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009896.1-709s1c1
Sequence:CCGGCGCATCCCTCTTAACCCGGTACTCGAGTACCGGGTTAAGAGGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009896.2-380s21c1
Sequence:CCGGTGGACGCCTGCGGCTTCTATTCTCGAGAATAGAAGCCGCAGGCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009896.2-747s21c1
Sequence:CCGGTAACCCGGTACTCCGTGACTACTCGAGTAGTCACGGAGTACCGGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009896.2-829s21c1
Sequence:CCGGGCGCCTTATTATTTCTTATTACTCGAGTAATAAGAAATAATAAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009896.2-477s21c1
Sequence:CCGGTCGCCAACGGAACTGCTTCTTCTCGAGAAGAAGCAGTTCCGTTGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009896.2-331s21c1
Sequence:CCGGTTCCGCTCCCACTCCGATTACCTCGAGGTAATCGGAGTGGGAGCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003745
SOCS1 MISSION shRNA Bacterial Glycerol Stock
suppressor of cytokine signaling 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003745.1-307s1c1
Sequence:CCGGCGACACGCACTTCCGCACATTCTCGAGAATGTGCGGAAGTGCGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057067    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_003745.1-313s1c1
Sequence:CCGGGCACTTCCGCACATTCCGTTCCTCGAGGAACGGAATGTGCGGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003745.1-308s1c1
Sequence:CCGGGACACGCACTTCCGCACATTCCTCGAGGAATGTGCGGAAGTGCGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003745.1-316s1c1
Sequence:CCGGCTTCCGCACATTCCGTTCGCACTCGAGTGCGAACGGAATGTGCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003745.1-325s21c1
Sequence:CCGGATTCCGTTCGCACGCCGATTACTCGAGTAATCGGCGTGCGAACGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003745.1-818s21c1
Sequence:CCGGTTAACTGGGATGCCGTGTTATCTCGAGATAACACGGCATCCCAGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003745.1-1009s21c1
Sequence:CCGGCTGGTTGTTGTAGCAGCTTAACTCGAGTTAAGCTGCTACAACAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003745.1-490s21c1
Sequence:CCGGTTTCGCCCTTAGCGTGAAGATCTCGAGATCTTCACGCTAAGGGCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003745
SOCS1 MISSION shRNA shRNA Plasmid DNA
suppressor of cytokine signaling 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003745.1-307s1c1
Sequence:CCGGCGACACGCACTTCCGCACATTCTCGAGAATGTGCGGAAGTGCGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057067    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_003745.1-313s1c1
Sequence:CCGGGCACTTCCGCACATTCCGTTCCTCGAGGAACGGAATGTGCGGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003745.1-308s1c1
Sequence:CCGGGACACGCACTTCCGCACATTCCTCGAGGAATGTGCGGAAGTGCGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003745.1-316s1c1
Sequence:CCGGCTTCCGCACATTCCGTTCGCACTCGAGTGCGAACGGAATGTGCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003745.1-325s21c1
Sequence:CCGGATTCCGTTCGCACGCCGATTACTCGAGTAATCGGCGTGCGAACGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003745.1-818s21c1
Sequence:CCGGTTAACTGGGATGCCGTGTTATCTCGAGATAACACGGCATCCCAGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003745.1-1009s21c1
Sequence:CCGGCTGGTTGTTGTAGCAGCTTAACTCGAGTTAAGCTGCTACAACAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003745.1-490s21c1
Sequence:CCGGTTTCGCCCTTAGCGTGAAGATCTCGAGATCTTCACGCTAAGGGCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003745
SOCS1 MISSION shRNA Lentiviral Transduction Particles
suppressor of cytokine signaling 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003745.1-307s1c1
Sequence:CCGGCGACACGCACTTCCGCACATTCTCGAGAATGTGCGGAAGTGCGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057067    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_003745.1-313s1c1
Sequence:CCGGGCACTTCCGCACATTCCGTTCCTCGAGGAACGGAATGTGCGGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003745.1-308s1c1
Sequence:CCGGGACACGCACTTCCGCACATTCCTCGAGGAATGTGCGGAAGTGCGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003745.1-316s1c1
Sequence:CCGGCTTCCGCACATTCCGTTCGCACTCGAGTGCGAACGGAATGTGCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003745.1-325s21c1
Sequence:CCGGATTCCGTTCGCACGCCGATTACTCGAGTAATCGGCGTGCGAACGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378148    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003745.1-818s21c1
Sequence:CCGGTTAACTGGGATGCCGTGTTATCTCGAGATAACACGGCATCCCAGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356245    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003745.1-1009s21c1
Sequence:CCGGCTGGTTGTTGTAGCAGCTTAACTCGAGTTAAGCTGCTACAACAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003745.1-490s21c1
Sequence:CCGGTTTCGCCCTTAGCGTGAAGATCTCGAGATCTTCACGCTAAGGGCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks