EMAIL THIS PAGE TO A FRIEND

SOCS2

suppressor of cytokine signaling 2

Synonyms: CIS2 Cish2 SOCS-2 SSI-2 SSI2 STATI2
UniProtKB ID: O14508, A8K3D1, O14542, O95102, Q9UKS5
Gene ID:
Human(8835) Summary: This gene encodes a member of the suppressor of cytokine signaling (SOCS) family. SOCS family members are cytokine-inducible negative regulators of cytokine receptor signaling via the Janus kinase/signal transducer and activation of transcription pathway (the JAK/STAT pathway). SOCS family proteins interact with major molecules of signaling complexes to block further signal transduction, in part, by proteasomal depletion of receptors or signal-transducing proteins via ubiquitination. The expression of this gene can be induced by a subset of cytokines, including erythropoietin, GM-CSF, IL10, interferon (IFN)-gamma and by cytokine receptors such as growth horomone receptor. The protein encoded by this gene interacts with the cytoplasmic domain of insulin-like growth factor-1 receptor (IGF1R) and is thought to be involved in the regulation of IGF1R mediated cell signaling. This gene has pseudogenes on chromosomes 20 and 22. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Mouse(216233) suppressor of cytokine signaling 2
Rat(84607) suppressor of cytokine signaling 2
Zebrafish(562062) suppressor of cytokine signaling 2
domestic cat(101080980) suppressor of cytokine signaling 2
dog(482603) suppressor of cytokine signaling 2
chicken(395219) suppressor of cytokine signaling 2
domestic guinea pig(100716104) suppressor of cytokine signaling 2
cow(338437) suppressor of cytokine signaling 2
sheep(101115017) suppressor of cytokine signaling 2
132 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007706 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007706 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007706 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003877 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003877 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003877 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001181 MISSION® esiRNA esiRNA targeting human SOCS2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003877 Rosetta Predictions human pricing
NM_058208 Rosetta Predictions rat pricing
NM_007706 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003877 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056234 predicted 898
2 SASI_Hs01_00056235 predicted 814
3 SASI_Hs01_00056237 predicted 1339
4 SASI_Hs02_00336470 predicted 816
5 SASI_Hs02_00336471 predicted 914
6 SASI_Hs01_00056239 predicted 784
7 SASI_Hs01_00056240 predicted 1160
8 SASI_Hs01_00056241 predicted 1050
9 SASI_Hs01_00056242 predicted 907
10 SASI_Hs01_00056243 predicted 739
11 SASI_Hs01_00056236 predicted 1309
12 SASI_Hs01_00056238 predicted 979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058208 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093419 predicted 447
2 SASI_Rn01_00093420 predicted 408
3 SASI_Rn01_00093423 predicted 566
4 SASI_Rn01_00093424 predicted 419
5 SASI_Rn02_00267175 predicted 414
6 SASI_Rn01_00093425 predicted 492
7 SASI_Rn01_00093426 predicted 457
8 SASI_Rn01_00093427 predicted 365
9 SASI_Rn01_00093428 predicted 553
10 SASI_Rn02_00267176 predicted 553
11 SASI_Rn01_00093421 predicted 447
12 SASI_Rn01_00093422 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007706 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312270 predicted 612
2 SASI_Mm01_00049322 predicted 651
3 SASI_Mm02_00312271 predicted 737
4 SASI_Mm01_00049324 predicted 662
5 SASI_Mm01_00049326 predicted 618
6 SASI_Mm01_00049327 predicted 682
7 SASI_Mm01_00049328 predicted 584
8 SASI_Mm01_00049329 predicted 703
9 SASI_Mm01_00049330 predicted 579
10 SASI_Mm02_00312272 predicted 614
11 SASI_Mm01_00049323 predicted 761
12 SASI_Mm01_00049325 predicted 787
13 SASI_Mm01_00049331 predicted 790
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007706
VALIDATED
SOCS2 MISSION shRNA Bacterial Glycerol Stock
suppressor of cytokine signaling 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007706.4-773s21c1
Sequence:CCGGTCAGATTGGATTCTATCATATCTCGAGATATGATAGAATCCAATCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007706.4-630s21c1
Sequence:CCGGTGAAGCCAAAGAGAAATTAAACTCGAGTTTAATTTCTCTTTGGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007706.4-1104s21c1
Sequence:CCGGACATGCCTCATATAGACTATCCTCGAGGATAGTCTATATGAGGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007706.1-971s1c1
Sequence:CCGGCTAACTTAAAGGTGTGAAGATCTCGAGATCTTCACACCTTTAAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007706.1-462s1c1
Sequence:CCGGCCTACTAACTATATCCGTTAACTCGAGTTAACGGATATAGTTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007706.1-765s1c1
Sequence:CCGGGCCTTTACCAACAAGACTAAACTCGAGTTTAGTCTTGTTGGTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007706.1-348s1c1
Sequence:CCGGGCTCAGTCAAACAGGATGGTACTCGAGTACCATCCTGTTTGACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007706.1-664s1c1
Sequence:CCGGGTTCACCTGTACCTGACCAAACTCGAGTTTGGTCAGGTACAGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007706
VALIDATED
SOCS2 MISSION shRNA shRNA Plasmid DNA
suppressor of cytokine signaling 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007706.4-773s21c1
Sequence:CCGGTCAGATTGGATTCTATCATATCTCGAGATATGATAGAATCCAATCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007706.4-630s21c1
Sequence:CCGGTGAAGCCAAAGAGAAATTAAACTCGAGTTTAATTTCTCTTTGGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007706.4-1104s21c1
Sequence:CCGGACATGCCTCATATAGACTATCCTCGAGGATAGTCTATATGAGGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007706.1-971s1c1
Sequence:CCGGCTAACTTAAAGGTGTGAAGATCTCGAGATCTTCACACCTTTAAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007706.1-462s1c1
Sequence:CCGGCCTACTAACTATATCCGTTAACTCGAGTTAACGGATATAGTTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007706.1-765s1c1
Sequence:CCGGGCCTTTACCAACAAGACTAAACTCGAGTTTAGTCTTGTTGGTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007706.1-348s1c1
Sequence:CCGGGCTCAGTCAAACAGGATGGTACTCGAGTACCATCCTGTTTGACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007706.1-664s1c1
Sequence:CCGGGTTCACCTGTACCTGACCAAACTCGAGTTTGGTCAGGTACAGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007706
VALIDATED
SOCS2 MISSION shRNA Lentiviral Transduction Particles
suppressor of cytokine signaling 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007706.4-773s21c1
Sequence:CCGGTCAGATTGGATTCTATCATATCTCGAGATATGATAGAATCCAATCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007706.4-630s21c1
Sequence:CCGGTGAAGCCAAAGAGAAATTAAACTCGAGTTTAATTTCTCTTTGGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007706.4-1104s21c1
Sequence:CCGGACATGCCTCATATAGACTATCCTCGAGGATAGTCTATATGAGGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067358    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007706.1-971s1c1
Sequence:CCGGCTAACTTAAAGGTGTGAAGATCTCGAGATCTTCACACCTTTAAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007706.1-462s1c1
Sequence:CCGGCCTACTAACTATATCCGTTAACTCGAGTTAACGGATATAGTTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007706.1-765s1c1
Sequence:CCGGGCCTTTACCAACAAGACTAAACTCGAGTTTAGTCTTGTTGGTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007706.1-348s1c1
Sequence:CCGGGCTCAGTCAAACAGGATGGTACTCGAGTACCATCCTGTTTGACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007706.1-664s1c1
Sequence:CCGGGTTCACCTGTACCTGACCAAACTCGAGTTTGGTCAGGTACAGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003877
SOCS2 MISSION shRNA Bacterial Glycerol Stock
suppressor of cytokine signaling 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003877.3-1301s21c1
Sequence:CCGGAGCTGAAGCTAATCTAATTTACTCGAGTAAATTAGATTAGCTTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003877.3-901s21c1
Sequence:CCGGTCAGATTGGACTCTATCATATCTCGAGATATGATAGAGTCCAATCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003877.3-817s1c1
Sequence:CCGGCGCATTCAGACTACCTACTAACTCGAGTTAGTAGGTAGTCTGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003877.3-787s1c1
Sequence:CCGGCAGAAGGAACTTTCTTGATTACTCGAGTAATCAAGAAAGTTCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003877.3-864s1c1
Sequence:CCGGCCAACTAATCTTCGAATCGAACTCGAGTTCGATTCGAAGATTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003877.3-1032s1c1
Sequence:CCGGGTTCACCTTTATCTGACCAAACTCGAGTTTGGTCAGATAAAGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003877.3-957s1c1
Sequence:CCGGGTTCATCTGATCGACTACTATCTCGAGATAGTAGTCGATCAGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003877
SOCS2 MISSION shRNA shRNA Plasmid DNA
suppressor of cytokine signaling 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003877.3-1301s21c1
Sequence:CCGGAGCTGAAGCTAATCTAATTTACTCGAGTAAATTAGATTAGCTTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003877.3-901s21c1
Sequence:CCGGTCAGATTGGACTCTATCATATCTCGAGATATGATAGAGTCCAATCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003877.3-817s1c1
Sequence:CCGGCGCATTCAGACTACCTACTAACTCGAGTTAGTAGGTAGTCTGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003877.3-787s1c1
Sequence:CCGGCAGAAGGAACTTTCTTGATTACTCGAGTAATCAAGAAAGTTCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003877.3-864s1c1
Sequence:CCGGCCAACTAATCTTCGAATCGAACTCGAGTTCGATTCGAAGATTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003877.3-1032s1c1
Sequence:CCGGGTTCACCTTTATCTGACCAAACTCGAGTTTGGTCAGATAAAGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003877.3-957s1c1
Sequence:CCGGGTTCATCTGATCGACTACTATCTCGAGATAGTAGTCGATCAGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003877
SOCS2 MISSION shRNA Lentiviral Transduction Particles
suppressor of cytokine signaling 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003877.3-1301s21c1
Sequence:CCGGAGCTGAAGCTAATCTAATTTACTCGAGTAAATTAGATTAGCTTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003877.3-901s21c1
Sequence:CCGGTCAGATTGGACTCTATCATATCTCGAGATATGATAGAGTCCAATCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003877.3-817s1c1
Sequence:CCGGCGCATTCAGACTACCTACTAACTCGAGTTAGTAGGTAGTCTGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003877.3-787s1c1
Sequence:CCGGCAGAAGGAACTTTCTTGATTACTCGAGTAATCAAGAAAGTTCCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003877.3-864s1c1
Sequence:CCGGCCAACTAATCTTCGAATCGAACTCGAGTTCGATTCGAAGATTAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003877.3-1032s1c1
Sequence:CCGGGTTCACCTTTATCTGACCAAACTCGAGTTTGGTCAGATAAAGGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003877.3-957s1c1
Sequence:CCGGGTTCATCTGATCGACTACTATCTCGAGATAGTAGTCGATCAGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks