EMAIL THIS PAGE TO A FRIEND

SOCS3

suppressor of cytokine signaling 3

Synonyms: ATOD4 CIS3 Cish3 SOCS-3 SSI-3 SSI3
UniProtKB ID: O14543, O14509
Gene ID:
Human(9021) Summary: This gene encodes a member of the STAT-induced STAT inhibitor (SSI), also known as suppressor of cytokine signaling (SOCS), family. SSI family members are cytokine-inducible negative regulators of cytokine signaling. The expression of this gene is induced by various cytokines, including IL6, IL10, and interferon (IFN)-gamma. The protein encoded by this gene can bind to JAK2 kinase, and inhibit the activity of JAK2 kinase. Studies of the mouse counterpart of this gene suggested the roles of this gene in the negative regulation of fetal liver hematopoiesis, and placental development. [provided by RefSeq, Jul 2008]
Mouse(12702) suppressor of cytokine signaling 3
Rat(89829) suppressor of cytokine signaling 3
chicken(395299) suppressor of cytokine signaling 3
Horse(100050730) suppressor of cytokine signaling 3
domestic cat(101081846) suppressor of cytokine signaling 3
dog(442949) suppressor of cytokine signaling 3
cow(282081) suppressor of cytokine signaling 3
sheep(100294595) suppressor of cytokine signaling 3
domestic guinea pig(100725088) suppressor of cytokine signaling 3
naked mole-rat(101704157) suppressor of cytokine signaling 3
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007707 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007707 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007707 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003955 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003955 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003955 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003955 Rosetta Predictions human pricing
NM_053565 Rosetta Predictions rat pricing
NM_007707 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179195 predicted 612
2 SASI_Hs01_00179197 predicted 1056
3 SASI_Hs01_00179198 predicted 1466
4 SASI_Hs01_00179199 predicted 675
5 SASI_Hs01_00179200 predicted 1322
6 SASI_Hs02_00336625 predicted 1500
7 SASI_Hs01_00179202 predicted 1106
8 SASI_Hs01_00179203 predicted 1000
9 SASI_Hs01_00179204 predicted 1465
10 SASI_Hs02_00336626 predicted 1474
11 SASI_Hs01_00179196 predicted 1406
12 SASI_Hs01_00179201 predicted 1174
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053565 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092297 predicted 364
2 SASI_Rn02_00266224 predicted 435
3 SASI_Rn01_00092299 predicted 353
4 SASI_Rn01_00092300 predicted 359
5 SASI_Rn01_00092301 predicted 437
6 SASI_Rn01_00092302 predicted 590
7 SASI_Rn01_00092303 predicted 435
8 SASI_Rn02_00266225 predicted 498
9 SASI_Rn01_00092304 predicted 583
10 SASI_Rn01_00092306 predicted 280
11 SASI_Rn01_00092298 predicted 506
12 SASI_Rn01_00092305 predicted 566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007707 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079404 predicted 1310
2 SASI_Mm01_00079405 predicted 1098
3 SASI_Mm02_00312273 predicted 1100
4 SASI_Mm01_00079406 predicted 608
5 SASI_Mm01_00079407 predicted 857
6 SASI_Mm01_00079408 predicted 1026
7 SASI_Mm01_00079409 predicted 717
8 SASI_Mm01_00079410 predicted 787
9 SASI_Mm01_00079411 predicted 934
10 SASI_Mm01_00079412 predicted 1445
11 SASI_Mm01_00079413 predicted 967
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007707
VALIDATED
SOCS3 MISSION shRNA Bacterial Glycerol Stock
suppressor of cytokine signaling 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007707.2-1871s1c1
Sequence:CCGGGCTAGGAGACTCGCCTTAAATCTCGAGATTTAAGGCGAGTCTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007707.2-1031s1c1
Sequence:CCGGGATCAGTATGATGCTCCACTTCTCGAGAAGTGGAGCATCATACTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007707.2-610s1c1
Sequence:CCGGCTTCTTCACGTTGAGCGTCAACTCGAGTTGACGCTCAACGTGAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007707.2-496s1c1
Sequence:CCGGGCTGCAGGAGAGCGGATTCTACTCGAGTAGAATCCGCTCTCCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007707.2-859s1c1
Sequence:CCGGCAAGAGAGCTTACTACATCTACTCGAGTAGATGTAGTAAGCTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007707.2-612s21c1
Sequence:CCGGTCTTCACGTTGAGCGTCAAGACTCGAGTCTTGACGCTCAACGTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007707.2-1870s21c1
Sequence:CCGGGGCTAGGAGACTCGCCTTAAACTCGAGTTTAAGGCGAGTCTCCTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007707.2-722s21c1
Sequence:CCGGCGCTTCGACTGTGTACTCAAGCTCGAGCTTGAGTACACAGTCGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007707.2-1034s21c1
Sequence:CCGGCAGTATGATGCTCCACTTTAACTCGAGTTAAAGTGGAGCATCATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007707.2-862s21c1
Sequence:CCGGGAGAGCTTACTACATCTATTCCTCGAGGAATAGATGTAGTAAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007707
VALIDATED
SOCS3 MISSION shRNA shRNA Plasmid DNA
suppressor of cytokine signaling 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007707.2-1871s1c1
Sequence:CCGGGCTAGGAGACTCGCCTTAAATCTCGAGATTTAAGGCGAGTCTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007707.2-1031s1c1
Sequence:CCGGGATCAGTATGATGCTCCACTTCTCGAGAAGTGGAGCATCATACTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007707.2-610s1c1
Sequence:CCGGCTTCTTCACGTTGAGCGTCAACTCGAGTTGACGCTCAACGTGAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007707.2-496s1c1
Sequence:CCGGGCTGCAGGAGAGCGGATTCTACTCGAGTAGAATCCGCTCTCCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007707.2-859s1c1
Sequence:CCGGCAAGAGAGCTTACTACATCTACTCGAGTAGATGTAGTAAGCTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007707.2-612s21c1
Sequence:CCGGTCTTCACGTTGAGCGTCAAGACTCGAGTCTTGACGCTCAACGTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007707.2-1870s21c1
Sequence:CCGGGGCTAGGAGACTCGCCTTAAACTCGAGTTTAAGGCGAGTCTCCTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007707.2-722s21c1
Sequence:CCGGCGCTTCGACTGTGTACTCAAGCTCGAGCTTGAGTACACAGTCGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007707.2-1034s21c1
Sequence:CCGGCAGTATGATGCTCCACTTTAACTCGAGTTAAAGTGGAGCATCATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007707.2-862s21c1
Sequence:CCGGGAGAGCTTACTACATCTATTCCTCGAGGAATAGATGTAGTAAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007707
VALIDATED
SOCS3 MISSION shRNA Lentiviral Transduction Particles
suppressor of cytokine signaling 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067468    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007707.2-1871s1c1
Sequence:CCGGGCTAGGAGACTCGCCTTAAATCTCGAGATTTAAGGCGAGTCTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007707.2-1031s1c1
Sequence:CCGGGATCAGTATGATGCTCCACTTCTCGAGAAGTGGAGCATCATACTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007707.2-610s1c1
Sequence:CCGGCTTCTTCACGTTGAGCGTCAACTCGAGTTGACGCTCAACGTGAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007707.2-496s1c1
Sequence:CCGGGCTGCAGGAGAGCGGATTCTACTCGAGTAGAATCCGCTCTCCTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007707.2-859s1c1
Sequence:CCGGCAAGAGAGCTTACTACATCTACTCGAGTAGATGTAGTAAGCTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007707.2-612s21c1
Sequence:CCGGTCTTCACGTTGAGCGTCAAGACTCGAGTCTTGACGCTCAACGTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007707.2-1870s21c1
Sequence:CCGGGGCTAGGAGACTCGCCTTAAACTCGAGTTTAAGGCGAGTCTCCTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007707.2-722s21c1
Sequence:CCGGCGCTTCGACTGTGTACTCAAGCTCGAGCTTGAGTACACAGTCGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007707.2-1034s21c1
Sequence:CCGGCAGTATGATGCTCCACTTTAACTCGAGTTAAAGTGGAGCATCATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007707.2-862s21c1
Sequence:CCGGGAGAGCTTACTACATCTATTCCTCGAGGAATAGATGTAGTAAGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003955
SOCS3 MISSION shRNA Bacterial Glycerol Stock
suppressor of cytokine signaling 3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000057074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003955.3-761s1c1
Sequence:CCGGCCGCTTCGACTGCGTGCTCAACTCGAGTTGAGCACGCAGTCGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003955.3-901s1c1
Sequence:CCGGGAAGAGCCTATTACATCTACTCTCGAGAGTAGATGTAATAGGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003955.3-548s1c1
Sequence:CCGGCGGCTTCTACTGGAGCGCAGTCTCGAGACTGCGCTCCAGTAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003955.3-1022s1c1
Sequence:CCGGCTCCTATGAGAAAGTCACCCACTCGAGTGGGTGACTTTCTCATAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003955
SOCS3 MISSION shRNA shRNA Plasmid DNA
suppressor of cytokine signaling 3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000057074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003955.3-761s1c1
Sequence:CCGGCCGCTTCGACTGCGTGCTCAACTCGAGTTGAGCACGCAGTCGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003955.3-901s1c1
Sequence:CCGGGAAGAGCCTATTACATCTACTCTCGAGAGTAGATGTAATAGGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003955.3-548s1c1
Sequence:CCGGCGGCTTCTACTGGAGCGCAGTCTCGAGACTGCGCTCCAGTAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003955.3-1022s1c1
Sequence:CCGGCTCCTATGAGAAAGTCACCCACTCGAGTGGGTGACTTTCTCATAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003955
SOCS3 MISSION shRNA Lentiviral Transduction Particles
suppressor of cytokine signaling 3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000057074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003955.3-761s1c1
Sequence:CCGGCCGCTTCGACTGCGTGCTCAACTCGAGTTGAGCACGCAGTCGAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003955.3-901s1c1
Sequence:CCGGGAAGAGCCTATTACATCTACTCTCGAGAGTAGATGTAATAGGCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003955.3-548s1c1
Sequence:CCGGCGGCTTCTACTGGAGCGCAGTCTCGAGACTGCGCTCCAGTAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003955.3-1022s1c1
Sequence:CCGGCTCCTATGAGAAAGTCACCCACTCGAGTGGGTGACTTTCTCATAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks