EMAIL THIS PAGE TO A FRIEND

SOCS4

suppressor of cytokine signaling 4

Synonyms: SOCS7
UniProtKB ID: Q8WXH5
Gene ID:
Human(122809) Summary: The protein encoded by this gene contains a SH2 domain and a SOCS BOX domain. The protein thus belongs to the suppressor of cytokine signaling (SOCS), also known as STAT-induced STAT inhibitor (SSI), protein family. SOCS family members are known to be cytokine-inducible negative regulators of cytokine signaling. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(67296) suppressor of cytokine signaling 4
Rat(305828) suppressor of cytokine signaling 4
Zebrafish(797891) suppressor of cytokine signaling 4
domestic cat(101080974) suppressor of cytokine signaling 4
Horse(100050301) suppressor of cytokine signaling 4
dog(100687271) suppressor of cytokine signaling 6
chicken(423557) suppressor of cytokine signaling 4
naked mole-rat(101704725) suppressor of cytokine signaling 4
domestic guinea pig(100735753) suppressor of cytokine signaling 4
cow(540412) suppressor of cytokine signaling 4
sheep(101117935) suppressor of cytokine signaling 4
286 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080843 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080843 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080843 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080867 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080867 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080867 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMNC007741 MISSION® Long Non-Coding esiRNA AK080408 targeting mouse mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080867 Rosetta Predictions human pricing
NM_199421 Rosetta Predictions human pricing
NM_001107256 Rosetta Predictions rat pricing
NM_080843 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080867 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065635 predicted 1171
2 SASI_Hs01_00065636 predicted 805
3 SASI_Hs02_00362659 predicted 920
4 SASI_Hs01_00065637 predicted 1073
5 SASI_Hs01_00065638 predicted 647
6 SASI_Hs01_00065639 predicted 1129
7 SASI_Hs01_00065640 predicted 741
8 SASI_Hs01_00065642 predicted 1232
9 SASI_Hs01_00065643 predicted 1538
10 SASI_Hs02_00362660 predicted 1030
11 SASI_Hs01_00065634 predicted 709
12 SASI_Hs01_00065641 predicted 1456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199421 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206205 predicted 1302
2 SASI_Hs01_00206206 predicted 938
3 SASI_Hs02_00372821 predicted 1052
4 SASI_Hs01_00206207 predicted 1197
5 SASI_Hs01_00206208 predicted 778
6 SASI_Hs01_00206209 predicted 1262
7 SASI_Hs01_00206210 predicted 871
8 SASI_Hs01_00206212 predicted 1364
9 SASI_Hs01_00206213 predicted 1671
10 SASI_Hs02_00372822 predicted 1161
11 SASI_Hs01_00206204 predicted 837
12 SASI_Hs01_00206211 predicted 1591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107256 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227045 predicted 937
2 SASI_Rn02_00227046 predicted 1149
3 SASI_Rn02_00227047 predicted 710
4 SASI_Rn02_00227048 predicted 1331
5 SASI_Rn02_00227049 predicted 240
6 SASI_Rn02_00227050 predicted 887
7 SASI_Rn02_00227051 predicted 396
8 SASI_Rn02_00227052 predicted 777
9 SASI_Rn02_00227053 predicted 1170
10 SASI_Rn02_00227054 predicted 1389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080843 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338217 predicted 310
2 SASI_Mm01_00046813 predicted 1328
3 SASI_Mm01_00046814 predicted 246
4 SASI_Mm01_00046815 predicted 1395
5 SASI_Mm01_00046816 predicted 378
6 SASI_Mm01_00046817 predicted 240
7 SASI_Mm01_00046818 predicted 1168
8 SASI_Mm01_00046819 predicted 531
9 SASI_Mm01_00046820 predicted 315
10 SASI_Mm01_00046822 predicted 1361
11 SASI_Mm01_00046821 predicted 377
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080843
VALIDATED
SOCS4 MISSION shRNA Bacterial Glycerol Stock
suppressor of cytokine signaling 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080843.2-1336s21c1
Sequence:CCGGTATTTGCAGAACGGTTATTTGCTCGAGCAAATAACCGTTCTGCAAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080843.2-1416s21c1
Sequence:CCGGATCTGAAGGAATACCATTATACTCGAGTATAATGGTATTCCTTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080843.2-401s21c1
Sequence:CCGGCATTCCTGTGGGCATAGATTTCTCGAGAAATCTATGCCCACAGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339941    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080843.2-1797s21c1
Sequence:CCGGCTAATCTATGCTATCAGTATTCTCGAGAATACTGATAGCATAGATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080843.2-1098s21c1
Sequence:CCGGATTCAGCGCAGGAAGATTATTCTCGAGAATAATCTTCCTGCGCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080843.2-1796s1c1
Sequence:CCGGGCTAATCTATGCTATCAGTATCTCGAGATACTGATAGCATAGATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080843.2-1397s1c1
Sequence:CCGGCCTTCGCCTATGAAATTGTATCTCGAGATACAATTTCATAGGCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080843.2-1333s1c1
Sequence:CCGGGCATATTTGCAGAACGGTTATCTCGAGATAACCGTTCTGCAAATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080843.2-719s1c1
Sequence:CCGGCCCTGTTTCTCACATACCAATCTCGAGATTGGTATGTGAGAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080843.2-1160s1c1
Sequence:CCGGGCTAGAATTGAGCAGTGGAATCTCGAGATTCCACTGCTCAATTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080843
VALIDATED
SOCS4 MISSION shRNA shRNA Plasmid DNA
suppressor of cytokine signaling 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080843.2-1336s21c1
Sequence:CCGGTATTTGCAGAACGGTTATTTGCTCGAGCAAATAACCGTTCTGCAAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080843.2-1416s21c1
Sequence:CCGGATCTGAAGGAATACCATTATACTCGAGTATAATGGTATTCCTTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080843.2-401s21c1
Sequence:CCGGCATTCCTGTGGGCATAGATTTCTCGAGAAATCTATGCCCACAGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339941    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080843.2-1797s21c1
Sequence:CCGGCTAATCTATGCTATCAGTATTCTCGAGAATACTGATAGCATAGATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080843.2-1098s21c1
Sequence:CCGGATTCAGCGCAGGAAGATTATTCTCGAGAATAATCTTCCTGCGCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080843.2-1796s1c1
Sequence:CCGGGCTAATCTATGCTATCAGTATCTCGAGATACTGATAGCATAGATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080843.2-1397s1c1
Sequence:CCGGCCTTCGCCTATGAAATTGTATCTCGAGATACAATTTCATAGGCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080843.2-1333s1c1
Sequence:CCGGGCATATTTGCAGAACGGTTATCTCGAGATAACCGTTCTGCAAATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080843.2-719s1c1
Sequence:CCGGCCCTGTTTCTCACATACCAATCTCGAGATTGGTATGTGAGAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080843.2-1160s1c1
Sequence:CCGGGCTAGAATTGAGCAGTGGAATCTCGAGATTCCACTGCTCAATTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080843
VALIDATED
SOCS4 MISSION shRNA Lentiviral Transduction Particles
suppressor of cytokine signaling 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080843.2-1336s21c1
Sequence:CCGGTATTTGCAGAACGGTTATTTGCTCGAGCAAATAACCGTTCTGCAAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080843.2-1416s21c1
Sequence:CCGGATCTGAAGGAATACCATTATACTCGAGTATAATGGTATTCCTTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080843.2-401s21c1
Sequence:CCGGCATTCCTGTGGGCATAGATTTCTCGAGAAATCTATGCCCACAGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339941    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080843.2-1797s21c1
Sequence:CCGGCTAATCTATGCTATCAGTATTCTCGAGAATACTGATAGCATAGATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_080843.2-1098s21c1
Sequence:CCGGATTCAGCGCAGGAAGATTATTCTCGAGAATAATCTTCCTGCGCTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067518    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080843.2-1796s1c1
Sequence:CCGGGCTAATCTATGCTATCAGTATCTCGAGATACTGATAGCATAGATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080843.2-1397s1c1
Sequence:CCGGCCTTCGCCTATGAAATTGTATCTCGAGATACAATTTCATAGGCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080843.2-1333s1c1
Sequence:CCGGGCATATTTGCAGAACGGTTATCTCGAGATAACCGTTCTGCAAATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080843.2-719s1c1
Sequence:CCGGCCCTGTTTCTCACATACCAATCTCGAGATTGGTATGTGAGAAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_080843.2-1160s1c1
Sequence:CCGGGCTAGAATTGAGCAGTGGAATCTCGAGATTCCACTGCTCAATTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080867
VALIDATED
SOCS4 MISSION shRNA Bacterial Glycerol Stock
suppressor of cytokine signaling 4
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000057069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080867.2-1659s1c1
Sequence:CCGGCCCTTCCAATTCCTTCTTCTACTCGAGTAGAAGAAGGAATTGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080867.2-1433s1c1
Sequence:CCGGGCTAGAATTGAACAGTGGAATCTCGAGATTCCACTGTTCAATTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080867.2-1032s1c1
Sequence:CCGGCCACCGACAATGCTTTGTGTACTCGAGTACACAAAGCATTGTCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080867.2-1204s1c1
Sequence:CCGGGCAGTTGGAAACACCTCCTAACTCGAGTTAGGAGGTGTTTCCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080867
VALIDATED
SOCS4 MISSION shRNA shRNA Plasmid DNA
suppressor of cytokine signaling 4
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000057069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080867.2-1659s1c1
Sequence:CCGGCCCTTCCAATTCCTTCTTCTACTCGAGTAGAAGAAGGAATTGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080867.2-1433s1c1
Sequence:CCGGGCTAGAATTGAACAGTGGAATCTCGAGATTCCACTGTTCAATTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080867.2-1032s1c1
Sequence:CCGGCCACCGACAATGCTTTGTGTACTCGAGTACACAAAGCATTGTCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080867.2-1204s1c1
Sequence:CCGGGCAGTTGGAAACACCTCCTAACTCGAGTTAGGAGGTGTTTCCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080867
VALIDATED
SOCS4 MISSION shRNA Lentiviral Transduction Particles
suppressor of cytokine signaling 4
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000057069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080867.2-1659s1c1
Sequence:CCGGCCCTTCCAATTCCTTCTTCTACTCGAGTAGAAGAAGGAATTGGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080867.2-1433s1c1
Sequence:CCGGGCTAGAATTGAACAGTGGAATCTCGAGATTCCACTGTTCAATTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080867.2-1032s1c1
Sequence:CCGGCCACCGACAATGCTTTGTGTACTCGAGTACACAAAGCATTGTCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_080867.2-1204s1c1
Sequence:CCGGGCAGTTGGAAACACCTCCTAACTCGAGTTAGGAGGTGTTTCCAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks