EMAIL THIS PAGE TO A FRIEND

SOCS5

suppressor of cytokine signaling 5

Synonyms: CIS6 CISH6 Cish5 SOCS-5
UniProtKB ID: O75159, Q53SD4, Q8IYZ4
Gene ID:
Human(9655) Summary: The protein encoded by this gene contains a SH2 domain and a SOCS BOX domain. The protein thus belongs to the suppressor of cytokine signaling (SOCS) family, also known as STAT-induced STAT inhibitor (SSI) protein family. SOCS family members are known to be cytokine-inducible negative regulators of cytokine signaling. The specific function of this protein has not yet been determined. Two alternatively spliced transcript variants encoding an identical protein have been reported. [provided by RefSeq, Jul 2008]
Mouse(56468) suppressor of cytokine signaling 5
Rat(500616) suppressor of cytokine signaling 5
chicken(428570) suppressor of cytokine signaling 5
domestic cat(101080522) suppressor of cytokine signaling 5
Horse(100053252) suppressor of cytokine signaling 5
dog(474581) suppressor of cytokine signaling 5
cow(514773) suppressor of cytokine signaling 5
sheep(101109082) suppressor of cytokine signaling 5
domestic guinea pig(100722912) suppressor of cytokine signaling 5
naked mole-rat(101703084) suppressor of cytokine signaling 5
Domestic Rabbit(100353407) suppressor of cytokine signaling 5
245 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019654 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019654 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019654 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014011 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014011 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014011 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014011 Rosetta Predictions human pricing
NM_144949 Rosetta Predictions human pricing
NM_001109274 Rosetta Predictions rat pricing
NM_019654 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014011 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113668 predicted 846
2 SASI_Hs01_00113669 predicted 1867
3 SASI_Hs01_00113671 predicted 1271
4 SASI_Hs01_00113672 predicted 1829
5 SASI_Hs01_00113673 predicted 563
6 SASI_Hs01_00113675 predicted 675
7 SASI_Hs01_00113676 predicted 1113
8 SASI_Hs02_00344982 predicted 650
9 SASI_Hs02_00344983 predicted 656
10 SASI_Hs01_00113677 predicted 796
11 SASI_Hs01_00113670 predicted 1809
12 SASI_Hs01_00113674 predicted 1041
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144949 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086380 predicted 939
2 SASI_Hs01_00086381 predicted 1961
3 SASI_Hs01_00086383 predicted 1360
4 SASI_Hs01_00086384 predicted 1918
5 SASI_Hs01_00086385 predicted 644
6 SASI_Hs01_00086387 predicted 763
7 SASI_Hs01_00086388 predicted 1209
8 SASI_Hs02_00364737 predicted 744
9 SASI_Hs02_00364738 predicted 741
10 SASI_Hs01_00086389 predicted 884
11 SASI_Hs01_00086382 predicted 1897
12 SASI_Hs01_00086386 predicted 1125
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109274 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246804 predicted 1861
2 SASI_Rn02_00246805 predicted 1994
3 SASI_Rn02_00246806 predicted 1430
4 SASI_Rn02_00246807 predicted 1218
5 SASI_Rn02_00246808 predicted 2066
6 SASI_Rn02_00246809 predicted 1159
7 SASI_Rn02_00246810 predicted 1452
8 SASI_Rn02_00246811 predicted 397
9 SASI_Rn02_00246812 predicted 1811
10 SASI_Rn02_00246813 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019654 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137579 predicted 1361
2 SASI_Mm02_00324701 predicted 1288
3 SASI_Mm01_00137580 predicted 1233
4 SASI_Mm01_00137581 predicted 1501
5 SASI_Mm01_00137582 predicted 1879
6 SASI_Mm01_00137583 predicted 1908
7 SASI_Mm01_00137585 predicted 1220
8 SASI_Mm01_00137587 predicted 1378
9 SASI_Mm01_00137588 predicted 1562
10 SASI_Mm02_00324702 predicted 1411
11 SASI_Mm01_00137584 predicted 816
12 SASI_Mm01_00137586 predicted 2032
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019654
VALIDATED
SOCS5 MISSION shRNA Bacterial Glycerol Stock
suppressor of cytokine signaling 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019654.2-3405s1c1
Sequence:CCGGCCGTGCTAATAAAGTATGTTTCTCGAGAAACATACTTTATTAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019654.2-1313s1c1
Sequence:CCGGGCACAGGTCAACCCATTGTATCTCGAGATACAATGGGTTGACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019654.2-1415s1c1
Sequence:CCGGGAAGAGGATTCAACCACCCTACTCGAGTAGGGTGGTTGAATCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019654.2-517s1c1
Sequence:CCGGCCGTAATGAGAACGTGGAGATCTCGAGATCTCCACGTTCTCATTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019654.2-1286s1c1
Sequence:CCGGGCACAAATACACACCTTTGAACTCGAGTTCAAAGGTGTGTATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019654.2-1286s21c1
Sequence:CCGGGCACAAATACACACCTTTGAACTCGAGTTCAAAGGTGTGTATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305117    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019654.2-2146s21c1
Sequence:CCGGAGAATGGGAGCTTAGTCATTACTCGAGTAATGACTAAGCTCCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019654.2-1846s21c1
Sequence:CCGGTGAACCGTTGCTAACGATATCCTCGAGGATATCGTTAGCAACGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019654.2-1313s21c1
Sequence:CCGGGCACAGGTCAACCCATTGTATCTCGAGATACAATGGGTTGACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019654.2-1415s21c1
Sequence:CCGGGAAGAGGATTCAACCACCCTACTCGAGTAGGGTGGTTGAATCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019654
VALIDATED
SOCS5 MISSION shRNA shRNA Plasmid DNA
suppressor of cytokine signaling 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019654.2-3405s1c1
Sequence:CCGGCCGTGCTAATAAAGTATGTTTCTCGAGAAACATACTTTATTAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019654.2-1313s1c1
Sequence:CCGGGCACAGGTCAACCCATTGTATCTCGAGATACAATGGGTTGACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019654.2-1415s1c1
Sequence:CCGGGAAGAGGATTCAACCACCCTACTCGAGTAGGGTGGTTGAATCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019654.2-517s1c1
Sequence:CCGGCCGTAATGAGAACGTGGAGATCTCGAGATCTCCACGTTCTCATTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019654.2-1286s1c1
Sequence:CCGGGCACAAATACACACCTTTGAACTCGAGTTCAAAGGTGTGTATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019654.2-1286s21c1
Sequence:CCGGGCACAAATACACACCTTTGAACTCGAGTTCAAAGGTGTGTATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305117    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019654.2-2146s21c1
Sequence:CCGGAGAATGGGAGCTTAGTCATTACTCGAGTAATGACTAAGCTCCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019654.2-1846s21c1
Sequence:CCGGTGAACCGTTGCTAACGATATCCTCGAGGATATCGTTAGCAACGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019654.2-1313s21c1
Sequence:CCGGGCACAGGTCAACCCATTGTATCTCGAGATACAATGGGTTGACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019654.2-1415s21c1
Sequence:CCGGGAAGAGGATTCAACCACCCTACTCGAGTAGGGTGGTTGAATCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019654
VALIDATED
SOCS5 MISSION shRNA Lentiviral Transduction Particles
suppressor of cytokine signaling 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105750    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019654.2-3405s1c1
Sequence:CCGGCCGTGCTAATAAAGTATGTTTCTCGAGAAACATACTTTATTAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019654.2-1313s1c1
Sequence:CCGGGCACAGGTCAACCCATTGTATCTCGAGATACAATGGGTTGACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019654.2-1415s1c1
Sequence:CCGGGAAGAGGATTCAACCACCCTACTCGAGTAGGGTGGTTGAATCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019654.2-517s1c1
Sequence:CCGGCCGTAATGAGAACGTGGAGATCTCGAGATCTCCACGTTCTCATTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019654.2-1286s1c1
Sequence:CCGGGCACAAATACACACCTTTGAACTCGAGTTCAAAGGTGTGTATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019654.2-1286s21c1
Sequence:CCGGGCACAAATACACACCTTTGAACTCGAGTTCAAAGGTGTGTATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305117    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019654.2-2146s21c1
Sequence:CCGGAGAATGGGAGCTTAGTCATTACTCGAGTAATGACTAAGCTCCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019654.2-1846s21c1
Sequence:CCGGTGAACCGTTGCTAACGATATCCTCGAGGATATCGTTAGCAACGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019654.2-1313s21c1
Sequence:CCGGGCACAGGTCAACCCATTGTATCTCGAGATACAATGGGTTGACCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019654.2-1415s21c1
Sequence:CCGGGAAGAGGATTCAACCACCCTACTCGAGTAGGGTGGTTGAATCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014011
VALIDATED
SOCS5 MISSION shRNA Bacterial Glycerol Stock
suppressor of cytokine signaling 5
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014011.x-1214s1c1
Sequence:CCGGCCACACACAGATTGATTACATCTCGAGATGTAATCAATCTGTGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014011.x-2602s1c1
Sequence:CCGGCGCCCAAACAAGTCAGATAATCTCGAGATTATCTGACTTGTTTGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014011.x-1518s1c1
Sequence:CCGGGATCCCAGTTCGTGCATGTTTCTCGAGAAACATGCACGAACTGGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014011.x-1727s1c1
Sequence:CCGGAGAACCAGTCAAGGCAAAGTACTCGAGTACTTTGCCTTGACTGGTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014011.x-704s1c1
Sequence:CCGGTCCCATGAGAACTTACAGCAACTCGAGTTGCTGTAAGTTCTCATGGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014011.4-352s21c1
Sequence:GTACCGGTTGCCTTACAACTGGGATTAACTCGAGTTAATCCCAGTTGTAAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014011.4-1820s21c1
Sequence:GTACCGGGCATCAGACAGTACACCTATACTCGAGTATAGGTGTACTGTCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014011.4-1908s21c1
Sequence:GTACCGGTGCTACCTGCTGTTACTTATTCTCGAGAATAAGTAACAGCAGGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014011.4-796s21c1
Sequence:GTACCGGCTGAATTAATGCTTGAGAAATCTCGAGATTTCTCAAGCATTAATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014011.4-1930s21c1
Sequence:GTACCGGAGATAAACATGGTGCCTATTGCTCGAGCAATAGGCACCATGTTTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014011.4-741s21c1
Sequence:GTACCGGACTTACAGCAAGCAGTCAAAGCTCGAGCTTTGACTGCTTGCTGTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014011.4-323s21c1
Sequence:GTACCGGGCAACAAAGCAGTCCCTTAAGCTCGAGCTTAAGGGACTGCTTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_014011.4-1238s21c1
Sequence:GTACCGGAGTCCACACACAGATTGATTACTCGAGTAATCAATCTGTGTGTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_014011.4-1109s21c1
Sequence:GTACCGGTGCAATTCCACAAGCTAATTGCTCGAGCAATTAGCTTGTGGAATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_014011.4-2828s21c1
Sequence:CCGGAGGTACTGTACAACCATTATACTCGAGTATAATGGTTGTACAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014011.4-1568s21c1
Sequence:CCGGTGAACCATTGCTTACTATATCCTCGAGGATATAGTAAGCAATGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014011.4-1034s21c1
Sequence:CCGGTGCACAGGTTAATCCATTATACTCGAGTATAATGGATTAACCTGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014011.4-1073s21c1
Sequence:GTACCGGAGCTCCTGGAATGACTGAAATCTCGAGATTTCAGTCATTCCAGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014011
VALIDATED
SOCS5 MISSION shRNA shRNA Plasmid DNA
suppressor of cytokine signaling 5
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014011.x-1214s1c1
Sequence:CCGGCCACACACAGATTGATTACATCTCGAGATGTAATCAATCTGTGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014011.x-2602s1c1
Sequence:CCGGCGCCCAAACAAGTCAGATAATCTCGAGATTATCTGACTTGTTTGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014011.x-1518s1c1
Sequence:CCGGGATCCCAGTTCGTGCATGTTTCTCGAGAAACATGCACGAACTGGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014011.x-1727s1c1
Sequence:CCGGAGAACCAGTCAAGGCAAAGTACTCGAGTACTTTGCCTTGACTGGTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014011.x-704s1c1
Sequence:CCGGTCCCATGAGAACTTACAGCAACTCGAGTTGCTGTAAGTTCTCATGGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014011.4-352s21c1
Sequence:GTACCGGTTGCCTTACAACTGGGATTAACTCGAGTTAATCCCAGTTGTAAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014011.4-1820s21c1
Sequence:GTACCGGGCATCAGACAGTACACCTATACTCGAGTATAGGTGTACTGTCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014011.4-1908s21c1
Sequence:GTACCGGTGCTACCTGCTGTTACTTATTCTCGAGAATAAGTAACAGCAGGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014011.4-796s21c1
Sequence:GTACCGGCTGAATTAATGCTTGAGAAATCTCGAGATTTCTCAAGCATTAATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014011.4-1930s21c1
Sequence:GTACCGGAGATAAACATGGTGCCTATTGCTCGAGCAATAGGCACCATGTTTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014011.4-741s21c1
Sequence:GTACCGGACTTACAGCAAGCAGTCAAAGCTCGAGCTTTGACTGCTTGCTGTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014011.4-323s21c1
Sequence:GTACCGGGCAACAAAGCAGTCCCTTAAGCTCGAGCTTAAGGGACTGCTTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_014011.4-1238s21c1
Sequence:GTACCGGAGTCCACACACAGATTGATTACTCGAGTAATCAATCTGTGTGTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_014011.4-1109s21c1
Sequence:GTACCGGTGCAATTCCACAAGCTAATTGCTCGAGCAATTAGCTTGTGGAATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_014011.4-2828s21c1
Sequence:CCGGAGGTACTGTACAACCATTATACTCGAGTATAATGGTTGTACAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014011.4-1568s21c1
Sequence:CCGGTGAACCATTGCTTACTATATCCTCGAGGATATAGTAAGCAATGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014011.4-1034s21c1
Sequence:CCGGTGCACAGGTTAATCCATTATACTCGAGTATAATGGATTAACCTGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014011.4-1073s21c1
Sequence:GTACCGGAGCTCCTGGAATGACTGAAATCTCGAGATTTCAGTCATTCCAGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014011
VALIDATED
SOCS5 MISSION shRNA Lentiviral Transduction Particles
suppressor of cytokine signaling 5
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014011.x-1214s1c1
Sequence:CCGGCCACACACAGATTGATTACATCTCGAGATGTAATCAATCTGTGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001895    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014011.x-2602s1c1
Sequence:CCGGCGCCCAAACAAGTCAGATAATCTCGAGATTATCTGACTTGTTTGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014011.x-1518s1c1
Sequence:CCGGGATCCCAGTTCGTGCATGTTTCTCGAGAAACATGCACGAACTGGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014011.x-1727s1c1
Sequence:CCGGAGAACCAGTCAAGGCAAAGTACTCGAGTACTTTGCCTTGACTGGTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014011.x-704s1c1
Sequence:CCGGTCCCATGAGAACTTACAGCAACTCGAGTTGCTGTAAGTTCTCATGGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014011.4-352s21c1
Sequence:GTACCGGTTGCCTTACAACTGGGATTAACTCGAGTTAATCCCAGTTGTAAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014011.4-1820s21c1
Sequence:GTACCGGGCATCAGACAGTACACCTATACTCGAGTATAGGTGTACTGTCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014011.4-1908s21c1
Sequence:GTACCGGTGCTACCTGCTGTTACTTATTCTCGAGAATAAGTAACAGCAGGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014011.4-796s21c1
Sequence:GTACCGGCTGAATTAATGCTTGAGAAATCTCGAGATTTCTCAAGCATTAATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379875    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014011.4-1930s21c1
Sequence:GTACCGGAGATAAACATGGTGCCTATTGCTCGAGCAATAGGCACCATGTTTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014011.4-741s21c1
Sequence:GTACCGGACTTACAGCAAGCAGTCAAAGCTCGAGCTTTGACTGCTTGCTGTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014011.4-323s21c1
Sequence:GTACCGGGCAACAAAGCAGTCCCTTAAGCTCGAGCTTAAGGGACTGCTTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_014011.4-1238s21c1
Sequence:GTACCGGAGTCCACACACAGATTGATTACTCGAGTAATCAATCTGTGTGTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_014011.4-1109s21c1
Sequence:GTACCGGTGCAATTCCACAAGCTAATTGCTCGAGCAATTAGCTTGTGGAATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226420    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_014011.4-2828s21c1
Sequence:CCGGAGGTACTGTACAACCATTATACTCGAGTATAATGGTTGTACAGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014011.4-1568s21c1
Sequence:CCGGTGAACCATTGCTTACTATATCCTCGAGGATATAGTAAGCAATGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014011.4-1034s21c1
Sequence:CCGGTGCACAGGTTAATCCATTATACTCGAGTATAATGGATTAACCTGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014011.4-1073s21c1
Sequence:GTACCGGAGCTCCTGGAATGACTGAAATCTCGAGATTTCAGTCATTCCAGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks