EMAIL THIS PAGE TO A FRIEND

SOCS6

suppressor of cytokine signaling 6

Synonyms: CIS-4 CIS4 HSPC060 SOCS-4 SOCS-6 SOCS4 SSI4 STAI4 STATI4
UniProtKB ID: O14544, Q8WUM3
Gene ID:
Human(9306) Summary: The protein encoded by this gene contains a SH2 domain and a CIS homolog domain. The protein thus belongs to the cytokine-induced STAT inhibitor (CIS), also known as suppressor of cytokine signaling (SOCS) or STAT-induced STAT inhibitor (SSI), protein family. CIS family members are known to be cytokine-inducible negative regulators of cytokine signaling. The expression of this gene can be induced by GM-CSF and EPO in hematopoietic cells. A high expression level of this gene was found in factor-independent chronic myelogenous leukemia (CML) and erythroleukemia (HEL) cell lines. [provided by RefSeq, Jul 2008]
Mouse(54607) suppressor of cytokine signaling 6
Rat(307200) suppressor of cytokine signaling 6
chicken(421020) suppressor of cytokine signaling 6
dog(476171) suppressor of cytokine signaling 6
domestic cat(101095049) suppressor of cytokine signaling 6
Horse(100052089) suppressor of cytokine signaling 6
Domestic Rabbit(100357417) suppressor of cytokine signaling 6
Domestic Rabbit(100344911) suppressor of cytokine signaling 6
naked mole-rat(101716336) suppressor of cytokine signaling 6
domestic guinea pig(100713080) suppressor of cytokine signaling 6
cow(615146) suppressor of cytokine signaling 6
sheep(101112276) suppressor of cytokine signaling 6
245 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004232 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004232 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004232 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018821 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018821 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018821 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004232 Rosetta Predictions human pricing
XM_001063512 Rosetta Predictions rat pricing
XM_225667 Rosetta Predictions rat pricing
NM_018821 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150058 predicted 1324
2 SASI_Hs01_00150060 predicted 1378
3 SASI_Hs01_00150061 predicted 927
4 SASI_Hs01_00150062 predicted 463
5 SASI_Hs01_00150063 predicted 1843
6 SASI_Hs02_00337156 predicted 1844
7 SASI_Hs01_00150064 predicted 1011
8 SASI_Hs01_00150065 predicted 1367
9 SASI_Hs01_00150066 predicted 1305
10 SASI_Hs01_00150067 predicted 1004
11 SASI_Hs01_00150059 predicted 1534
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063512 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307392 predicted 1466
2 SASI_Rn02_00307393 predicted 1763
3 SASI_Rn02_00307394 predicted 1149
4 SASI_Rn02_00307395 predicted 1015
5 SASI_Rn02_00307396 predicted 601
6 SASI_Rn02_00307397 predicted 1347
7 SASI_Rn02_00307398 predicted 1682
8 SASI_Rn02_00307399 predicted 1218
9 SASI_Rn02_00307400 predicted 1826
10 SASI_Rn02_00307401 predicted 1799
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225667 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383014 predicted 1457
2 SASI_Rn02_00383015 predicted 1762
3 SASI_Rn02_00383016 predicted 1149
4 SASI_Rn02_00383017 predicted 1017
5 SASI_Rn02_00383018 predicted 597
6 SASI_Rn02_00383019 predicted 1350
7 SASI_Rn02_00383020 predicted 1682
8 SASI_Rn02_00383021 predicted 1219
9 SASI_Rn02_00383022 predicted 1831
10 SASI_Rn02_00383023 predicted 1798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018821 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138987 predicted 781
2 SASI_Mm01_00138988 predicted 1901
3 SASI_Mm01_00138989 predicted 1978
4 SASI_Mm01_00138990 predicted 1813
5 SASI_Mm01_00138991 predicted 1481
6 SASI_Mm01_00138992 predicted 1281
7 SASI_Mm01_00138993 predicted 1121
8 SASI_Mm01_00138994 predicted 1354
9 SASI_Mm01_00138995 predicted 1938
10 SASI_Mm01_00138996 predicted 1592
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004232
VALIDATED
SOCS6 MISSION shRNA Bacterial Glycerol Stock
suppressor of cytokine signaling 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004232.3-1155s21c1
Sequence:CCGGTCGTGGATCAGTCCGTGAATGCTCGAGCATTCACGGACTGATCCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004232.3-5325s21c1
Sequence:CCGGCAATAGCCAGTTCCGTAAATACTCGAGTATTTACGGAACTGGCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004232.3-463s21c1
Sequence:CCGGAGATATGGCCAGCTGCGATATCTCGAGATATCGCAGCTGGCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004232.3-1845s21c1
Sequence:CCGGAGTATACCAGAATAGACTTAACTCGAGTTAAGTCTATTCTGGTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004232.3-1669s21c1
Sequence:CCGGTACGTCCATAGTTGATCTAATCTCGAGATTAGATCAACTATGGACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005499    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_004232.2-2155s1c1
Sequence:CCGGCCCTAAGTAAAGTTGAATGAACTCGAGTTCATTCAACTTTACTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_004232.2-1490s1c1
Sequence:CCGGGAGCACTCAAATGGTAGGTTTCTCGAGAAACCTACCATTTGAGTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004232.2-839s1c1
Sequence:CCGGCCTCAGGACTACATTCAGTATCTCGAGATACTGAATGTAGTCCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004232.2-817s1c1
Sequence:CCGGGCCTGTCGTTATTGGACTTATCTCGAGATAAGTCCAATAACGACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_004232.2-1199s1c1
Sequence:CCGGGCTGAAAGTATGCGCTGTCATCTCGAGATGACAGCGCATACTTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004232
VALIDATED
SOCS6 MISSION shRNA shRNA Plasmid DNA
suppressor of cytokine signaling 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004232.3-1155s21c1
Sequence:CCGGTCGTGGATCAGTCCGTGAATGCTCGAGCATTCACGGACTGATCCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004232.3-5325s21c1
Sequence:CCGGCAATAGCCAGTTCCGTAAATACTCGAGTATTTACGGAACTGGCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004232.3-463s21c1
Sequence:CCGGAGATATGGCCAGCTGCGATATCTCGAGATATCGCAGCTGGCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004232.3-1845s21c1
Sequence:CCGGAGTATACCAGAATAGACTTAACTCGAGTTAAGTCTATTCTGGTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004232.3-1669s21c1
Sequence:CCGGTACGTCCATAGTTGATCTAATCTCGAGATTAGATCAACTATGGACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005499    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_004232.2-2155s1c1
Sequence:CCGGCCCTAAGTAAAGTTGAATGAACTCGAGTTCATTCAACTTTACTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_004232.2-1490s1c1
Sequence:CCGGGAGCACTCAAATGGTAGGTTTCTCGAGAAACCTACCATTTGAGTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004232.2-839s1c1
Sequence:CCGGCCTCAGGACTACATTCAGTATCTCGAGATACTGAATGTAGTCCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004232.2-817s1c1
Sequence:CCGGGCCTGTCGTTATTGGACTTATCTCGAGATAAGTCCAATAACGACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_004232.2-1199s1c1
Sequence:CCGGGCTGAAAGTATGCGCTGTCATCTCGAGATGACAGCGCATACTTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004232
VALIDATED
SOCS6 MISSION shRNA Lentiviral Transduction Particles
suppressor of cytokine signaling 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004232.3-1155s21c1
Sequence:CCGGTCGTGGATCAGTCCGTGAATGCTCGAGCATTCACGGACTGATCCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004232.3-5325s21c1
Sequence:CCGGCAATAGCCAGTTCCGTAAATACTCGAGTATTTACGGAACTGGCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004232.3-463s21c1
Sequence:CCGGAGATATGGCCAGCTGCGATATCTCGAGATATCGCAGCTGGCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004232.3-1845s21c1
Sequence:CCGGAGTATACCAGAATAGACTTAACTCGAGTTAAGTCTATTCTGGTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004232.3-1669s21c1
Sequence:CCGGTACGTCCATAGTTGATCTAATCTCGAGATTAGATCAACTATGGACGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005499    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_004232.2-2155s1c1
Sequence:CCGGCCCTAAGTAAAGTTGAATGAACTCGAGTTCATTCAACTTTACTTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_004232.2-1490s1c1
Sequence:CCGGGAGCACTCAAATGGTAGGTTTCTCGAGAAACCTACCATTTGAGTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004232.2-839s1c1
Sequence:CCGGCCTCAGGACTACATTCAGTATCTCGAGATACTGAATGTAGTCCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004232.2-817s1c1
Sequence:CCGGGCCTGTCGTTATTGGACTTATCTCGAGATAAGTCCAATAACGACAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_004232.2-1199s1c1
Sequence:CCGGGCTGAAAGTATGCGCTGTCATCTCGAGATGACAGCGCATACTTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018821
VALIDATED
SOCS6 MISSION shRNA Bacterial Glycerol Stock
suppressor of cytokine signaling 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018821.3-395s21c1
Sequence:CCGGTTGCTGGTGACTTCGTGAAAGCTCGAGCTTTCACGAAGTCACCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018821.3-1648s21c1
Sequence:CCGGACATCTATAGTTGACTTAATCCTCGAGGATTAAGTCAACTATAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018821.3-1305s21c1
Sequence:CCGGCGAAAGTGTTCGCTGTCATTTCTCGAGAAATGACAGCGAACACTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018821.3-666s21c1
Sequence:CCGGACTGAGAAGCCACCATTATAGCTCGAGCTATAATGGTGGCTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018821.3-2940s21c1
Sequence:CCGGTTTGACCATTCTAACTCTAAACTCGAGTTTAGAGTTAGAATGGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018821.2-2227s1c1
Sequence:CCGGGCACATTTCATGTGTATTCAACTCGAGTTGAATACACATGAAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018821.2-1807s1c1
Sequence:CCGGCCGCTTTGTTATCCGTCAGTACTCGAGTACTGACGGATAACAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018821.2-1585s1c1
Sequence:CCGGCACTAGAATTGAGCACTCAAACTCGAGTTTGAGTGCTCAATTCTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018821.2-922s1c1
Sequence:CCGGGCCTGTAGTAATCGGACTCATCTCGAGATGAGTCCGATTACTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018821
VALIDATED
SOCS6 MISSION shRNA shRNA Plasmid DNA
suppressor of cytokine signaling 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018821.3-395s21c1
Sequence:CCGGTTGCTGGTGACTTCGTGAAAGCTCGAGCTTTCACGAAGTCACCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018821.3-1648s21c1
Sequence:CCGGACATCTATAGTTGACTTAATCCTCGAGGATTAAGTCAACTATAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018821.3-1305s21c1
Sequence:CCGGCGAAAGTGTTCGCTGTCATTTCTCGAGAAATGACAGCGAACACTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018821.3-666s21c1
Sequence:CCGGACTGAGAAGCCACCATTATAGCTCGAGCTATAATGGTGGCTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018821.3-2940s21c1
Sequence:CCGGTTTGACCATTCTAACTCTAAACTCGAGTTTAGAGTTAGAATGGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018821.2-2227s1c1
Sequence:CCGGGCACATTTCATGTGTATTCAACTCGAGTTGAATACACATGAAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018821.2-1807s1c1
Sequence:CCGGCCGCTTTGTTATCCGTCAGTACTCGAGTACTGACGGATAACAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018821.2-1585s1c1
Sequence:CCGGCACTAGAATTGAGCACTCAAACTCGAGTTTGAGTGCTCAATTCTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018821.2-922s1c1
Sequence:CCGGGCCTGTAGTAATCGGACTCATCTCGAGATGAGTCCGATTACTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018821
VALIDATED
SOCS6 MISSION shRNA Lentiviral Transduction Particles
suppressor of cytokine signaling 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018821.3-395s21c1
Sequence:CCGGTTGCTGGTGACTTCGTGAAAGCTCGAGCTTTCACGAAGTCACCAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018821.3-1648s21c1
Sequence:CCGGACATCTATAGTTGACTTAATCCTCGAGGATTAAGTCAACTATAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018821.3-1305s21c1
Sequence:CCGGCGAAAGTGTTCGCTGTCATTTCTCGAGAAATGACAGCGAACACTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018821.3-666s21c1
Sequence:CCGGACTGAGAAGCCACCATTATAGCTCGAGCTATAATGGTGGCTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018821.3-2940s21c1
Sequence:CCGGTTTGACCATTCTAACTCTAAACTCGAGTTTAGAGTTAGAATGGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018821.2-2227s1c1
Sequence:CCGGGCACATTTCATGTGTATTCAACTCGAGTTGAATACACATGAAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018821.2-1807s1c1
Sequence:CCGGCCGCTTTGTTATCCGTCAGTACTCGAGTACTGACGGATAACAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018821.2-1585s1c1
Sequence:CCGGCACTAGAATTGAGCACTCAAACTCGAGTTTGAGTGCTCAATTCTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018821.2-922s1c1
Sequence:CCGGGCCTGTAGTAATCGGACTCATCTCGAGATGAGTCCGATTACTACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks