EMAIL THIS PAGE TO A FRIEND

SOCS7

suppressor of cytokine signaling 7

Synonyms: NAP4 NCKAP4
UniProtKB ID: O14512, A2VCU2, Q0IJ63
Gene ID:
Mouse(192157) suppressor of cytokine signaling 7
Rat(287659) suppressor of cytokine signaling 7
Zebrafish(556903) suppressor of cytokine signaling 7
domestic cat(101098835) suppressor of cytokine signaling 7
dog(491039) suppressor of cytokine signaling 4
chicken(426232) suppressor of cytokine signaling 7
cow(540586) suppressor of cytokine signaling 7
sheep(101123392) suppressor of cytokine signaling 7
domestic guinea pig(100724639) suppressor of cytokine signaling 7
naked mole-rat(101725097) suppressor of cytokine signaling 7
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138657 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138657 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138657 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014598 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014598 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014598 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014598 Rosetta Predictions human pricing
XM_001081372 Rosetta Predictions rat pricing
XM_213443 Rosetta Predictions rat pricing
NM_138657 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014598 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073282 predicted 1522
2 SASI_Hs01_00073283 predicted 1565
3 SASI_Hs01_00073284 predicted 1769
4 SASI_Hs01_00073285 predicted 1770
5 SASI_Hs02_00345879 predicted 1215
6 SASI_Hs01_00073286 predicted 1348
7 SASI_Hs01_00073288 predicted 1742
8 SASI_Hs01_00073289 predicted 1399
9 SASI_Hs01_00073290 predicted 1705
10 SASI_Hs02_00345880 predicted 1402
11 SASI_Hs01_00073281 predicted 1678
12 SASI_Hs01_00073287 predicted 1452
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081372 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00371613 predicted 1757
2 SASI_Rn02_00371614 predicted 1209
3 SASI_Rn02_00371615 predicted 1394
4 SASI_Rn02_00371616 predicted 1174
5 SASI_Rn02_00371617 predicted 1601
6 SASI_Rn02_00371618 predicted 1597
7 SASI_Rn02_00371619 predicted 1638
8 SASI_Rn02_00371620 predicted 1321
9 SASI_Rn02_00371621 predicted 562
10 SASI_Rn02_00371622 predicted 1275
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213443 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374616 predicted 985
2 SASI_Rn02_00374617 predicted 1120
3 SASI_Rn02_00374618 predicted 894
4 SASI_Rn02_00374619 predicted 739
5 SASI_Rn02_00374620 predicted 752
6 SASI_Rn02_00374621 predicted 649
7 SASI_Rn02_00374622 predicted 1106
8 SASI_Rn02_00374623 predicted 902
9 SASI_Rn02_00374624 predicted 881
10 SASI_Rn02_00374625 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138657 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121598 predicted 1528
2 SASI_Mm01_00121599 predicted 1676
3 SASI_Mm01_00121600 predicted 1216
4 SASI_Mm01_00121602 predicted 1419
5 SASI_Mm01_00121603 predicted 1733
6 SASI_Mm02_00339715 predicted 724
7 SASI_Mm01_00121604 predicted 1450
8 SASI_Mm01_00121605 predicted 1408
9 SASI_Mm01_00121606 predicted 1887
10 SASI_Mm01_00121607 predicted 1635
11 SASI_Mm01_00121601 predicted 1538
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138657
VALIDATED
SOCS7 MISSION shRNA Bacterial Glycerol Stock
suppressor of cytokine signaling 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138657.2-1846s1c1
Sequence:CCGGGCTGTTGAACATGAAGGCATTCTCGAGAATGCCTTCATGTTCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138657.2-1730s1c1
Sequence:CCGGCGAAAGTTCTACTACTATGATCTCGAGATCATAGTAGTAGAACTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138657.2-886s1c1
Sequence:CCGGGACAAGAACTCAAAGTGCCTTCTCGAGAAGGCACTTTGAGTTCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138657.2-878s1c1
Sequence:CCGGCCCAGGTTGACAAGAACTCAACTCGAGTTGAGTTCTTGTCAACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138657.2-1525s1c1
Sequence:CCGGGCACTCCAAGAACGGGAAATTCTCGAGAATTTCCCGTTCTTGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138657
VALIDATED
SOCS7 MISSION shRNA shRNA Plasmid DNA
suppressor of cytokine signaling 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138657.2-1846s1c1
Sequence:CCGGGCTGTTGAACATGAAGGCATTCTCGAGAATGCCTTCATGTTCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138657.2-1730s1c1
Sequence:CCGGCGAAAGTTCTACTACTATGATCTCGAGATCATAGTAGTAGAACTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138657.2-886s1c1
Sequence:CCGGGACAAGAACTCAAAGTGCCTTCTCGAGAAGGCACTTTGAGTTCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138657.2-878s1c1
Sequence:CCGGCCCAGGTTGACAAGAACTCAACTCGAGTTGAGTTCTTGTCAACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138657.2-1525s1c1
Sequence:CCGGGCACTCCAAGAACGGGAAATTCTCGAGAATTTCCCGTTCTTGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138657
VALIDATED
SOCS7 MISSION shRNA Lentiviral Transduction Particles
suppressor of cytokine signaling 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138657.2-1846s1c1
Sequence:CCGGGCTGTTGAACATGAAGGCATTCTCGAGAATGCCTTCATGTTCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138657.2-1730s1c1
Sequence:CCGGCGAAAGTTCTACTACTATGATCTCGAGATCATAGTAGTAGAACTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138657.2-886s1c1
Sequence:CCGGGACAAGAACTCAAAGTGCCTTCTCGAGAAGGCACTTTGAGTTCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138657.2-878s1c1
Sequence:CCGGCCCAGGTTGACAAGAACTCAACTCGAGTTGAGTTCTTGTCAACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138657.2-1525s1c1
Sequence:CCGGGCACTCCAAGAACGGGAAATTCTCGAGAATTTCCCGTTCTTGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014598
VALIDATED
SOCS7 MISSION shRNA Bacterial Glycerol Stock
suppressor of cytokine signaling 7
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149985    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014598.1-1918s1c1
Sequence:CCGGCCAGCTTTGAAGAACCAAATTCTCGAGAATTTGGTTCTTCAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014598.1-1743s1c1
Sequence:CCGGGCCTAAACCTCTGATCTCTTACTCGAGTAAGAGATCAGAGGTTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014598.1-1744s1c1
Sequence:CCGGCCTAAACCTCTGATCTCTTATCTCGAGATAAGAGATCAGAGGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_014598.1-1568s1c1
Sequence:CCGGCCAAGAATGGAAAGTTTCTCTCTCGAGAGAGAAACTTTCCATTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014598.1-1986s1c1
Sequence:CCGGGATTCTCTGTGCAGAGACTTTCTCGAGAAAGTCTCTGCACAGAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014598
VALIDATED
SOCS7 MISSION shRNA shRNA Plasmid DNA
suppressor of cytokine signaling 7
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149985    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014598.1-1918s1c1
Sequence:CCGGCCAGCTTTGAAGAACCAAATTCTCGAGAATTTGGTTCTTCAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014598.1-1743s1c1
Sequence:CCGGGCCTAAACCTCTGATCTCTTACTCGAGTAAGAGATCAGAGGTTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014598.1-1744s1c1
Sequence:CCGGCCTAAACCTCTGATCTCTTATCTCGAGATAAGAGATCAGAGGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_014598.1-1568s1c1
Sequence:CCGGCCAAGAATGGAAAGTTTCTCTCTCGAGAGAGAAACTTTCCATTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014598.1-1986s1c1
Sequence:CCGGGATTCTCTGTGCAGAGACTTTCTCGAGAAAGTCTCTGCACAGAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014598
VALIDATED
SOCS7 MISSION shRNA Lentiviral Transduction Particles
suppressor of cytokine signaling 7
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149985    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014598.1-1918s1c1
Sequence:CCGGCCAGCTTTGAAGAACCAAATTCTCGAGAATTTGGTTCTTCAAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014598.1-1743s1c1
Sequence:CCGGGCCTAAACCTCTGATCTCTTACTCGAGTAAGAGATCAGAGGTTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_014598.1-1744s1c1
Sequence:CCGGCCTAAACCTCTGATCTCTTATCTCGAGATAAGAGATCAGAGGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_014598.1-1568s1c1
Sequence:CCGGCCAAGAATGGAAAGTTTCTCTCTCGAGAGAGAAACTTTCCATTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014598.1-1986s1c1
Sequence:CCGGGATTCTCTGTGCAGAGACTTTCTCGAGAAAGTCTCTGCACAGAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks