EMAIL THIS PAGE TO A FRIEND

SOD1

superoxide dismutase 1, soluble

Synonyms: ALS ALS1 IPOA SOD hSod1 homodimer
Gene ID:
Human(6647) Summary: The protein encoded by this gene binds copper and zinc ions and is one of two isozymes responsible for destroying free superoxide radicals in the body. The encoded isozyme is a soluble cytoplasmic protein, acting as a homodimer to convert naturally-occuring but harmful superoxide radicals to molecular oxygen and hydrogen peroxide. The other isozyme is a mitochondrial protein. Mutations in this gene have been implicated as causes of familial amyotrophic lateral sclerosis. Rare transcript variants have been reported for this gene. [provided by RefSeq, Jul 2008]
Mouse(20655) superoxide dismutase 1, soluble
Rat(24786) superoxide dismutase 1, soluble
Zebrafish(30553) superoxide dismutase 1, soluble
chicken(395938) superoxide dismutase 1, soluble
Horse(100033855) superoxide dismutase 1, soluble
domestic cat(101091804) superoxide dismutase 1, soluble
dog(403559) superoxide dismutase 1, soluble
Domestic Rabbit(100009313) superoxide dismutase 1, soluble
naked mole-rat(101713304) superoxide dismutase 1, soluble
domestic guinea pig(100135622) superoxide dismutase 1, soluble
cow(281495) superoxide dismutase 1, soluble
sheep(100270717) superoxide dismutase 1, soluble
sheep(101115136) superoxide dismutase 1, soluble
Goat(100861196) superoxide dismutase 1, soluble
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000454 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000454 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000454 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011434 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011434 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011434 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000454 Rosetta Predictions human pricing
NM_017050 Rosetta Predictions rat pricing
NM_011434 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230422 predicted 219
2 SASI_Hs01_00230423 predicted 267
3 SASI_Hs01_00230426 predicted 255
4 SASI_Hs01_00230427 predicted 299
5 SASI_Hs01_00230429 predicted 246
6 SASI_Hs01_00230430 predicted 278
7 SASI_Hs02_00302581 predicted 645
8 SASI_Hs01_00230421 predicted 333
9 SASI_Hs02_00302582 predicted 430
10 SASI_Hs02_00302583 predicted 583
11 SASI_Hs01_00230424 predicted 335
12 SASI_Hs01_00230425 predicted 331
13 SASI_Hs01_00230428 predicted 409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017050 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112871 predicted 257
2 SASI_Rn01_00112872 predicted 380
3 SASI_Rn01_00112873 predicted 422
4 SASI_Rn01_00112874 predicted 410
5 SASI_Rn01_00112875 predicted 263
6 SASI_Rn01_00112877 predicted 219
7 SASI_Rn02_00261236 predicted 346
8 SASI_Rn01_00112878 predicted 245
9 SASI_Rn01_00112879 predicted 374
10 SASI_Rn01_00112880 predicted 419
11 SASI_Rn01_00112876 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011434 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122733 predicted 608
2 SASI_Mm01_00122734 predicted 114
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000454
VALIDATED
SOD1 MISSION shRNA Bacterial Glycerol Stock
superoxide dismutase 1, soluble
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000454.x-122s1c1
Sequence:CCGGAGGCCTGCATGGATTCCATGTCTCGAGACATGGAATCCATGCAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_000454.x-465s1c1
Sequence:CCGGTCCCTTGGATGTAGTCTGAGGCTCGAGCCTCAGACTACATCCAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000454.x-368s1c1
Sequence:CCGGAGCAGATGACTTGGGCAAAGGCTCGAGCCTTTGCCCAAGTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000454.3-351s1c1
Sequence:CCGGCCGATGTGTCTATTGAAGATTCTCGAGAATCTTCAATAGACACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000454.3-453s1c1
Sequence:CCGGGTGGAAATGAAGAAAGTACAACTCGAGTTGTACTTTCTTCATTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000454.3-191s1c1
Sequence:CCGGCTGCATGGATTCCATGTTCATCTCGAGATGAACATGGAATCCATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000454.3-115s1c1
Sequence:CCGGCATCATCAATTTCGAGCAGAACTCGAGTTCTGCTCGAAATTGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000454.4-291s21c1
Sequence:CCGGTTCATGAGTTTGGAGATAATACTCGAGTATTATCTCCAAACTCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000454.4-517s21c1
Sequence:CCGGAGCAGATGACTTGGGCAAAGGCTCGAGCCTTTGCCCAAGTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000454.4-537s21c1
Sequence:CCGGGTGGAAATGAAGAAAGTACAACTCGAGTTGTACTTTCTTCATTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000454.4-666s21c1
Sequence:CCGGGCTGTAGAAATGTATCCTGATCTCGAGATCAGGATACATTTCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000454
VALIDATED
SOD1 MISSION shRNA shRNA Plasmid DNA
superoxide dismutase 1, soluble
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000454.x-122s1c1
Sequence:CCGGAGGCCTGCATGGATTCCATGTCTCGAGACATGGAATCCATGCAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_000454.x-465s1c1
Sequence:CCGGTCCCTTGGATGTAGTCTGAGGCTCGAGCCTCAGACTACATCCAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000454.x-368s1c1
Sequence:CCGGAGCAGATGACTTGGGCAAAGGCTCGAGCCTTTGCCCAAGTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000454.3-351s1c1
Sequence:CCGGCCGATGTGTCTATTGAAGATTCTCGAGAATCTTCAATAGACACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000454.3-453s1c1
Sequence:CCGGGTGGAAATGAAGAAAGTACAACTCGAGTTGTACTTTCTTCATTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000454.3-191s1c1
Sequence:CCGGCTGCATGGATTCCATGTTCATCTCGAGATGAACATGGAATCCATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000454.3-115s1c1
Sequence:CCGGCATCATCAATTTCGAGCAGAACTCGAGTTCTGCTCGAAATTGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000454.4-291s21c1
Sequence:CCGGTTCATGAGTTTGGAGATAATACTCGAGTATTATCTCCAAACTCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000454.4-517s21c1
Sequence:CCGGAGCAGATGACTTGGGCAAAGGCTCGAGCCTTTGCCCAAGTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000454.4-537s21c1
Sequence:CCGGGTGGAAATGAAGAAAGTACAACTCGAGTTGTACTTTCTTCATTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000454.4-666s21c1
Sequence:CCGGGCTGTAGAAATGTATCCTGATCTCGAGATCAGGATACATTTCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000454
VALIDATED
SOD1 MISSION shRNA Lentiviral Transduction Particles
superoxide dismutase 1, soluble
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000454.x-122s1c1
Sequence:CCGGAGGCCTGCATGGATTCCATGTCTCGAGACATGGAATCCATGCAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_000454.x-465s1c1
Sequence:CCGGTCCCTTGGATGTAGTCTGAGGCTCGAGCCTCAGACTACATCCAAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000454.x-368s1c1
Sequence:CCGGAGCAGATGACTTGGGCAAAGGCTCGAGCCTTTGCCCAAGTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000454.3-351s1c1
Sequence:CCGGCCGATGTGTCTATTGAAGATTCTCGAGAATCTTCAATAGACACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_000454.3-453s1c1
Sequence:CCGGGTGGAAATGAAGAAAGTACAACTCGAGTTGTACTTTCTTCATTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000454.3-191s1c1
Sequence:CCGGCTGCATGGATTCCATGTTCATCTCGAGATGAACATGGAATCCATGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000454.3-115s1c1
Sequence:CCGGCATCATCAATTTCGAGCAGAACTCGAGTTCTGCTCGAAATTGATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000454.4-291s21c1
Sequence:CCGGTTCATGAGTTTGGAGATAATACTCGAGTATTATCTCCAAACTCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000454.4-517s21c1
Sequence:CCGGAGCAGATGACTTGGGCAAAGGCTCGAGCCTTTGCCCAAGTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000454.4-537s21c1
Sequence:CCGGGTGGAAATGAAGAAAGTACAACTCGAGTTGTACTTTCTTCATTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000454.4-666s21c1
Sequence:CCGGGCTGTAGAAATGTATCCTGATCTCGAGATCAGGATACATTTCTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011434
VALIDATED
SOD1 MISSION shRNA Bacterial Glycerol Stock
superoxide dismutase 1, soluble
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011434.1-201s1c1
Sequence:CCGGCCAGTTGTGTTGTCAGGACAACTCGAGTTGTCCTGACAACACAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011434.1-476s1c1
Sequence:CCGGCCATGAGAAACAAGATGACTTCTCGAGAAGTCATCTTGTTTCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011434.1-214s1c1
Sequence:CCGGCAGGACAAATTACAGGATTAACTCGAGTTAATCCTGTAATTTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011434.1-402s1c1
Sequence:CCGGGCCAATGTGTCCATTGAAGATCTCGAGATCTTCAATGGACACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011434.1-499s1c1
Sequence:CCGGGCAAAGGTGGAAATGAAGAAACTCGAGTTTCTTCATTTCCACCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011434.1-499s21c1
Sequence:CCGGGCAAAGGTGGAAATGAAGAAACTCGAGTTTCTTCATTTCCACCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011434.1-476s21c1
Sequence:CCGGCCATGAGAAACAAGATGACTTCTCGAGAAGTCATCTTGTTTCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011434.1-402s21c1
Sequence:CCGGGCCAATGTGTCCATTGAAGATCTCGAGATCTTCAATGGACACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011434.1-201s21c1
Sequence:CCGGCCAGTTGTGTTGTCAGGACAACTCGAGTTGTCCTGACAACACAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011434
VALIDATED
SOD1 MISSION shRNA shRNA Plasmid DNA
superoxide dismutase 1, soluble
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011434.1-201s1c1
Sequence:CCGGCCAGTTGTGTTGTCAGGACAACTCGAGTTGTCCTGACAACACAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011434.1-476s1c1
Sequence:CCGGCCATGAGAAACAAGATGACTTCTCGAGAAGTCATCTTGTTTCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011434.1-214s1c1
Sequence:CCGGCAGGACAAATTACAGGATTAACTCGAGTTAATCCTGTAATTTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011434.1-402s1c1
Sequence:CCGGGCCAATGTGTCCATTGAAGATCTCGAGATCTTCAATGGACACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011434.1-499s1c1
Sequence:CCGGGCAAAGGTGGAAATGAAGAAACTCGAGTTTCTTCATTTCCACCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011434.1-499s21c1
Sequence:CCGGGCAAAGGTGGAAATGAAGAAACTCGAGTTTCTTCATTTCCACCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011434.1-476s21c1
Sequence:CCGGCCATGAGAAACAAGATGACTTCTCGAGAAGTCATCTTGTTTCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011434.1-402s21c1
Sequence:CCGGGCCAATGTGTCCATTGAAGATCTCGAGATCTTCAATGGACACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011434.1-201s21c1
Sequence:CCGGCCAGTTGTGTTGTCAGGACAACTCGAGTTGTCCTGACAACACAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011434
VALIDATED
SOD1 MISSION shRNA Lentiviral Transduction Particles
superoxide dismutase 1, soluble
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011434.1-201s1c1
Sequence:CCGGCCAGTTGTGTTGTCAGGACAACTCGAGTTGTCCTGACAACACAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011434.1-476s1c1
Sequence:CCGGCCATGAGAAACAAGATGACTTCTCGAGAAGTCATCTTGTTTCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011434.1-214s1c1
Sequence:CCGGCAGGACAAATTACAGGATTAACTCGAGTTAATCCTGTAATTTGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011434.1-402s1c1
Sequence:CCGGGCCAATGTGTCCATTGAAGATCTCGAGATCTTCAATGGACACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011434.1-499s1c1
Sequence:CCGGGCAAAGGTGGAAATGAAGAAACTCGAGTTTCTTCATTTCCACCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011434.1-499s21c1
Sequence:CCGGGCAAAGGTGGAAATGAAGAAACTCGAGTTTCTTCATTTCCACCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011434.1-476s21c1
Sequence:CCGGCCATGAGAAACAAGATGACTTCTCGAGAAGTCATCTTGTTTCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011434.1-402s21c1
Sequence:CCGGGCCAATGTGTCCATTGAAGATCTCGAGATCTTCAATGGACACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011434.1-201s21c1
Sequence:CCGGCCAGTTGTGTTGTCAGGACAACTCGAGTTGTCCTGACAACACAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks