EMAIL THIS PAGE TO A FRIEND

SOD2

superoxide dismutase 2, mitochondrial

Synonyms: IPOB MNSOD MVCD6
Gene ID:
Human(6648) Summary: This gene is a member of the iron/manganese superoxide dismutase family. It encodes a mitochondrial protein that forms a homotetramer and binds one manganese ion per subunit. This protein binds to the superoxide byproducts of oxidative phosphorylation and converts them to hydrogen peroxide and diatomic oxygen. Mutations in this gene have been associated with idiopathic cardiomyopathy (IDC), premature aging, sporadic motor neuron disease, and cancer. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(20656) superoxide dismutase 2, mitochondrial
Rat(24787) superoxide dismutase 2, mitochondrial
fruit fly(36878) Superoxide dismutase 2 (Mn)
chicken(374042) superoxide dismutase 2, mitochondrial
Zebrafish(335799) superoxide dismutase 2, mitochondrial
dog(476258) superoxide dismutase 2, mitochondrial
Horse(100034223) superoxide dismutase 2, mitochondrial
domestic cat(101096985) superoxide dismutase 2, mitochondrial
cow(281496) superoxide dismutase 2, mitochondrial
sheep(780457) superoxide dismutase 2, mitochondrial
domestic guinea pig(100135623) superoxide dismutase 2, mitochondrial
naked mole-rat(101714164) superoxide dismutase 2, mitochondrial
96 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501675 Anti-SOD2 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, bovine, pig
ELISA, western blot pricing
SAB2501676 Anti-SOD2 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, rat, zebrafish, mouse, canine, pig, bovine
ELISA, western blot pricing
SAB1406465 Anti-SOD2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2701618 Anti-sod2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB2701761 Anti-sod2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
HPA001814 Anti-SOD2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunohistochemistry, western blot pricing
SAB2102261 Anti-SOD2 antibody produced in rabbit affinity isolated antibody horse, rat, rabbit, mouse, goat, human, guinea pig, sheep
western blot pricing
S5069 Anti-Superoxide Dismutase (MnSOD) (DD-17) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, rat
immunofluorescence, immunohistochemistry, western blot pricing
S1450 Anti-Superoxide Dismutase (MnSOD) (DD-17)−Cy3 antibody produced in rabbit 1-2 mg/mL, affinity isolated antibody, buffered aqueous solution rat, mouse, human
immunofluorescence pricing
S5569 Anti-Superoxide Dismutase (MnSOD) (KC-19) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, rat
immunofluorescence, western blot pricing
SAB2702309 Monoclonal Anti-SOD2 antibody produced in mouse clone GT582, affinity isolated antibody human, rat, mouse
western blot pricing
SAB2702310 Monoclonal Anti-SOD2 antibody produced in mouse clone GT1433, affinity isolated antibody rat, human, mouse
western blot pricing
SAB2702311 Monoclonal Anti-SOD2 antibody produced in mouse clone GT17112, affinity isolated antibody rat, human, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000636 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000636 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000636 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013671 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013671 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013671 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000636 Rosetta Predictions human pricing
NM_001024465 Rosetta Predictions human pricing
NM_001024466 Rosetta Predictions human pricing
NM_017051 Rosetta Predictions rat pricing
NM_013671 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000636 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187266 predicted 429
2 SASI_Hs01_00187267 predicted 588
3 SASI_Hs01_00187268 predicted 392
4 SASI_Hs01_00187271 predicted 373
5 SASI_Hs01_00187272 predicted 412
6 SASI_Hs01_00187273 predicted 542
7 SASI_Hs02_00302985 predicted 524
8 SASI_Hs01_00187274 predicted 416
9 SASI_Hs01_00187275 predicted 532
10 SASI_Hs02_00302986 predicted 522
11 SASI_Hs01_00187269 predicted 523
12 SASI_Hs01_00187270 predicted 477
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024465 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045084 predicted 715
2 SASI_Hs01_00045085 predicted 713
3 SASI_Hs02_00307169 predicted 730
4 SASI_Hs01_00045087 predicted 757
5 SASI_Hs01_00045088 predicted 759
6 SASI_Hs01_00045089 predicted 738
7 SASI_Hs01_00045090 predicted 704
8 SASI_Hs02_00307170 predicted 784
9 SASI_Hs01_00045091 predicted 710
10 SASI_Hs01_00045092 predicted 704
11 SASI_Hs01_00045086 predicted 800
12 SASI_Hs01_00045093 predicted 797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024466 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175206 predicted 598
2 SASI_Hs01_00175207 predicted 590
3 SASI_Hs02_00307171 predicted 617
4 SASI_Hs01_00175209 predicted 635
5 SASI_Hs01_00175210 predicted 648
6 SASI_Hs01_00175211 predicted 621
7 SASI_Hs01_00175212 predicted 595
8 SASI_Hs02_00307172 predicted 668
9 SASI_Hs01_00175213 predicted 596
10 SASI_Hs01_00175214 predicted 586
11 SASI_Hs01_00175208 predicted 679
12 SASI_Hs01_00175215 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017051 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064419 predicted 682
2 SASI_Rn01_00064420 predicted 358
3 SASI_Rn01_00064421 predicted 633
4 SASI_Rn02_00261237 predicted 476
5 SASI_Rn01_00064422 predicted 640
6 SASI_Rn01_00064423 predicted 836
7 SASI_Rn02_00261238 predicted 824
8 SASI_Rn02_00261239 predicted 542
9 SASI_Rn01_00064424 predicted 844
10 SASI_Rn01_00064425 predicted 303
11 SASI_Rn01_00064426 predicted 685
12 SASI_Rn01_00064427 predicted 695
13 SASI_Rn01_00064428 predicted 871
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013671 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322512 predicted 765
2 SASI_Mm02_00322513 predicted 1066
3 SASI_Mm02_00322514 predicted 1111
4 SASI_Mm02_00322515 predicted 681
5 SASI_Mm02_00322516 predicted 979
6 SASI_Mm02_00322517 predicted 818
7 SASI_Mm02_00322518 predicted 981
8 SASI_Mm02_00322519 predicted 801
9 SASI_Mm02_00322520 predicted 1102
10 SASI_Mm02_00322521 predicted 792
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000636
VALIDATED
SOD2 MISSION shRNA Bacterial Glycerol Stock
superoxide dismutase 2, mitochondrial
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000636.2-528s21c1
Sequence:CCGGTTGGTTCCTTTGACAAGTTTACTCGAGTAAACTTGTCAAAGGAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000636.2-429s21c1
Sequence:CCGGGTGGTGGTCATATCAATCATACTCGAGTATGATTGATATGACCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000636.2-1132s21c1
Sequence:CCGGGGATGCCTTTCTAGTCCTATTCTCGAGAATAGGACTAGAAAGGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000636.2-712s21c1
Sequence:CCGGGCACGCTTACTACCTTCAGTACTCGAGTACTGAAGGTAGTAAGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000636.2-664s21c1
Sequence:CCGGGCAAGGAACAACAGGCCTTATCTCGAGATAAGGCCTGTTGTTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000636.1-688s1c1
Sequence:CCGGGCTGAGTATGTTAAGCTCTTTCTCGAGAAAGAGCTTAACATACTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000636.1-359s1c1
Sequence:CCGGGAAGCCATCAAACTGGACTTTCTCGAGAAAGTCCAGTTTGATGGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000636.1-514s1c1
Sequence:CCGGGCAAGGAACAACAGGCCTTATCTCGAGATAAGGCCTGTTGTTCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000636.1-562s1c1
Sequence:CCGGGCACGCTTACTACCTTCAGTACTCGAGTACTGAAGGTAGTAAGCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000636.1-279s1c1
Sequence:CCGGGTGGTGGTCATATCAATCATACTCGAGTATGATTGATATGACCACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000636
VALIDATED
SOD2 MISSION shRNA shRNA Plasmid DNA
superoxide dismutase 2, mitochondrial
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000636.2-528s21c1
Sequence:CCGGTTGGTTCCTTTGACAAGTTTACTCGAGTAAACTTGTCAAAGGAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000636.2-429s21c1
Sequence:CCGGGTGGTGGTCATATCAATCATACTCGAGTATGATTGATATGACCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000636.2-1132s21c1
Sequence:CCGGGGATGCCTTTCTAGTCCTATTCTCGAGAATAGGACTAGAAAGGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000636.2-712s21c1
Sequence:CCGGGCACGCTTACTACCTTCAGTACTCGAGTACTGAAGGTAGTAAGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000636.2-664s21c1
Sequence:CCGGGCAAGGAACAACAGGCCTTATCTCGAGATAAGGCCTGTTGTTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000636.1-688s1c1
Sequence:CCGGGCTGAGTATGTTAAGCTCTTTCTCGAGAAAGAGCTTAACATACTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000636.1-359s1c1
Sequence:CCGGGAAGCCATCAAACTGGACTTTCTCGAGAAAGTCCAGTTTGATGGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000636.1-514s1c1
Sequence:CCGGGCAAGGAACAACAGGCCTTATCTCGAGATAAGGCCTGTTGTTCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000636.1-562s1c1
Sequence:CCGGGCACGCTTACTACCTTCAGTACTCGAGTACTGAAGGTAGTAAGCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000636.1-279s1c1
Sequence:CCGGGTGGTGGTCATATCAATCATACTCGAGTATGATTGATATGACCACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000636
VALIDATED
SOD2 MISSION shRNA Lentiviral Transduction Particles
superoxide dismutase 2, mitochondrial
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000636.2-528s21c1
Sequence:CCGGTTGGTTCCTTTGACAAGTTTACTCGAGTAAACTTGTCAAAGGAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000636.2-429s21c1
Sequence:CCGGGTGGTGGTCATATCAATCATACTCGAGTATGATTGATATGACCACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000636.2-1132s21c1
Sequence:CCGGGGATGCCTTTCTAGTCCTATTCTCGAGAATAGGACTAGAAAGGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_000636.2-712s21c1
Sequence:CCGGGCACGCTTACTACCTTCAGTACTCGAGTACTGAAGGTAGTAAGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000636.2-664s21c1
Sequence:CCGGGCAAGGAACAACAGGCCTTATCTCGAGATAAGGCCTGTTGTTCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000636.1-688s1c1
Sequence:CCGGGCTGAGTATGTTAAGCTCTTTCTCGAGAAAGAGCTTAACATACTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000636.1-359s1c1
Sequence:CCGGGAAGCCATCAAACTGGACTTTCTCGAGAAAGTCCAGTTTGATGGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000636.1-514s1c1
Sequence:CCGGGCAAGGAACAACAGGCCTTATCTCGAGATAAGGCCTGTTGTTCCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000636.1-562s1c1
Sequence:CCGGGCACGCTTACTACCTTCAGTACTCGAGTACTGAAGGTAGTAAGCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_000636.1-279s1c1
Sequence:CCGGGTGGTGGTCATATCAATCATACTCGAGTATGATTGATATGACCACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013671
VALIDATED
SOD2 MISSION shRNA Bacterial Glycerol Stock
superoxide dismutase 2, mitochondrial
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013671.3-769s21c1
Sequence:CCGGGCTTACTACCTTCAGTATAAACTCGAGTTTATACTGAAGGTAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305671    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013671.3-1027s21c1
Sequence:CCGGTCTATTCTTAGGCAACTATTTCTCGAGAAATAGTTGCCTAAGAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013671.3-293s21c1
Sequence:CCGGCAGACCTGCCTTACGACTATGCTCGAGCATAGTCGTAAGGCAGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013671.3-799s21c1
Sequence:CCGGCCTGACTATCTGAAAGCTATTCTCGAGAATAGCTTTCAGATAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013671.3-562s21c1
Sequence:CCGGGAGGCTATCAAGCGTGACTTTCTCGAGAAAGTCACGCTTGATAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013671.3-3084s1c1
Sequence:CCGGCCCAAACCTATCGTGTCCATTCTCGAGAATGGACACGATAGGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013671.3-324s1c1
Sequence:CCGGGCCACACATTAACGCGCAGATCTCGAGATCTGCGCGTTAATGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013671.3-696s1c1
Sequence:CCGGCTGCTCTAATCAGGACCCATTCTCGAGAATGGGTCCTGATTAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013671.3-562s1c1
Sequence:CCGGGAGGCTATCAAGCGTGACTTTCTCGAGAAAGTCACGCTTGATAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013671.3-799s1c1
Sequence:CCGGCCTGACTATCTGAAAGCTATTCTCGAGAATAGCTTTCAGATAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013671
VALIDATED
SOD2 MISSION shRNA shRNA Plasmid DNA
superoxide dismutase 2, mitochondrial
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013671.3-769s21c1
Sequence:CCGGGCTTACTACCTTCAGTATAAACTCGAGTTTATACTGAAGGTAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305671    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013671.3-1027s21c1
Sequence:CCGGTCTATTCTTAGGCAACTATTTCTCGAGAAATAGTTGCCTAAGAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013671.3-293s21c1
Sequence:CCGGCAGACCTGCCTTACGACTATGCTCGAGCATAGTCGTAAGGCAGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013671.3-799s21c1
Sequence:CCGGCCTGACTATCTGAAAGCTATTCTCGAGAATAGCTTTCAGATAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013671.3-562s21c1
Sequence:CCGGGAGGCTATCAAGCGTGACTTTCTCGAGAAAGTCACGCTTGATAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013671.3-3084s1c1
Sequence:CCGGCCCAAACCTATCGTGTCCATTCTCGAGAATGGACACGATAGGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013671.3-324s1c1
Sequence:CCGGGCCACACATTAACGCGCAGATCTCGAGATCTGCGCGTTAATGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013671.3-696s1c1
Sequence:CCGGCTGCTCTAATCAGGACCCATTCTCGAGAATGGGTCCTGATTAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013671.3-562s1c1
Sequence:CCGGGAGGCTATCAAGCGTGACTTTCTCGAGAAAGTCACGCTTGATAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013671.3-799s1c1
Sequence:CCGGCCTGACTATCTGAAAGCTATTCTCGAGAATAGCTTTCAGATAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013671
VALIDATED
SOD2 MISSION shRNA Lentiviral Transduction Particles
superoxide dismutase 2, mitochondrial
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013671.3-769s21c1
Sequence:CCGGGCTTACTACCTTCAGTATAAACTCGAGTTTATACTGAAGGTAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305671    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013671.3-1027s21c1
Sequence:CCGGTCTATTCTTAGGCAACTATTTCTCGAGAAATAGTTGCCTAAGAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013671.3-293s21c1
Sequence:CCGGCAGACCTGCCTTACGACTATGCTCGAGCATAGTCGTAAGGCAGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013671.3-799s21c1
Sequence:CCGGCCTGACTATCTGAAAGCTATTCTCGAGAATAGCTTTCAGATAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013671.3-562s21c1
Sequence:CCGGGAGGCTATCAAGCGTGACTTTCTCGAGAAAGTCACGCTTGATAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013671.3-3084s1c1
Sequence:CCGGCCCAAACCTATCGTGTCCATTCTCGAGAATGGACACGATAGGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013671.3-324s1c1
Sequence:CCGGGCCACACATTAACGCGCAGATCTCGAGATCTGCGCGTTAATGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013671.3-696s1c1
Sequence:CCGGCTGCTCTAATCAGGACCCATTCTCGAGAATGGGTCCTGATTAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013671.3-562s1c1
Sequence:CCGGGAGGCTATCAAGCGTGACTTTCTCGAGAAAGTCACGCTTGATAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013671.3-799s1c1
Sequence:CCGGCCTGACTATCTGAAAGCTATTCTCGAGAATAGCTTTCAGATAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks