EMAIL THIS PAGE TO A FRIEND

SOD3

superoxide dismutase 3, extracellular

Synonyms: EC-SOD
UniProtKB ID: P08294, Q5U781, Q6FHA2
Gene ID:
Human(6649) Summary: This gene encodes a member of the superoxide dismutase (SOD) protein family. SODs are antioxidant enzymes that catalyze the dismutation of two superoxide radicals into hydrogen peroxide and oxygen. The product of this gene is thought to protect the brain, lungs, and other tissues from oxidative stress. The protein is secreted into the extracellular space and forms a glycosylated homotetramer that is anchored to the extracellular matrix (ECM) and cell surfaces through an interaction with heparan sulfate proteoglycan and collagen. A fraction of the protein is cleaved near the C-terminus before secretion to generate circulating tetramers that do not interact with the ECM. [provided by RefSeq, Jul 2008]
Mouse(20657) superoxide dismutase 3, extracellular
Rat(25352) superoxide dismutase 3, extracellular
fruit fly(36232) Superoxide dismutase 3
chicken(422810) superoxide dismutase 3, extracellular
dog(488855) superoxide dismutase 3, extracellular
naked mole-rat(101703009) superoxide dismutase 3, extracellular
Domestic Rabbit(100009320) superoxide dismutase 3, extracellular
domestic guinea pig(100718762) superoxide dismutase 3, extracellular
cow(532481) superoxide dismutase 3, extracellular
Goat(100860810) superoxide dismutase 3, extracellular
sheep(101104150) superoxide dismutase 3, extracellular
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003102 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003102 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003102 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011435 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011435 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011435 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU066051 MISSION® esiRNA esiRNA targeting mouse Sod3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003102 Rosetta Predictions human pricing
NM_012880 Rosetta Predictions rat pricing
NM_011435 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003102 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335062 predicted 996
2 SASI_Hs02_00335063 predicted 1019
3 SASI_Hs01_00125087 predicted 300
4 SASI_Hs02_00335064 predicted 206
5 SASI_Hs01_00125089 predicted 332
6 SASI_Hs01_00125090 predicted 536
7 SASI_Hs02_00335065 predicted 1022
8 SASI_Hs01_00125093 predicted 331
9 SASI_Hs01_00125094 predicted 881
10 SASI_Hs02_00335066 predicted 328
11 SASI_Hs01_00125086 predicted 1459
12 SASI_Hs01_00125088 predicted 1490
13 SASI_Hs01_00125091 predicted 1240
14 SASI_Hs01_00125092 predicted 1466
15 SASI_Hs01_00125095 predicted 1484
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012880 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070897 predicted 197
2 SASI_Rn01_00070898 predicted 889
3 SASI_Rn01_00070899 predicted 1171
4 SASI_Rn01_00070900 predicted 425
5 SASI_Rn01_00070901 predicted 1036
6 SASI_Rn01_00070902 predicted 617
7 SASI_Rn01_00070903 predicted 932
8 SASI_Rn02_00260389 predicted 316
9 SASI_Rn01_00070904 predicted 483
10 SASI_Rn01_00070906 predicted 826
11 SASI_Rn01_00070905 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011435 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056485 predicted 1305
2 SASI_Mm01_00056486 predicted 1309
3 SASI_Mm01_00056487 predicted 472
4 SASI_Mm01_00056488 predicted 1420
5 SASI_Mm01_00056489 predicted 1135
6 SASI_Mm01_00056490 predicted 1210
7 SASI_Mm01_00056491 predicted 980
8 SASI_Mm01_00056492 predicted 1198
9 SASI_Mm01_00056493 predicted 547
10 SASI_Mm01_00056494 predicted 746
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003102
SOD3 MISSION shRNA Bacterial Glycerol Stock
superoxide dismutase 3, extracellular
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003102.1-765s1c1
Sequence:CCGGGATCCGAGACATGTACGCCAACTCGAGTTGGCGTACATGTCTCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003102.1-942s1c1
Sequence:CCGGCGACGCCTTCTTCGCCCTGGACTCGAGTCCAGGGCGAAGAAGGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003102.1-1095s1c1
Sequence:CCGGCGACTTCGGCAACTTCGCGGTCTCGAGACCGCGAAGTTGCCGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003102.1-741s1c1
Sequence:CCGGGCCCAACTCTGACTCGGCGGACTCGAGTCCGCCGAGTCAGAGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003102.2-1155s21c1
Sequence:CCGGGGCCTCCATTTGTACCGAAACCTCGAGGTTTCGGTACAAATGGAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003102.2-875s21c1
Sequence:CCGGGAGCACTCAGAGCGCAAGAAGCTCGAGCTTCTTGCGCTCTGAGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003102.2-336s21c1
Sequence:CCGGAGATCTGGCAGGAGGTCATGCCTCGAGGCATGACCTCCTGCCAGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003102.2-1019s21c1
Sequence:CCGGTGAGGTCTCACCTTCGCCTTTCTCGAGAAAGGCGAAGGTGAGACCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003102
SOD3 MISSION shRNA shRNA Plasmid DNA
superoxide dismutase 3, extracellular
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003102.1-765s1c1
Sequence:CCGGGATCCGAGACATGTACGCCAACTCGAGTTGGCGTACATGTCTCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003102.1-942s1c1
Sequence:CCGGCGACGCCTTCTTCGCCCTGGACTCGAGTCCAGGGCGAAGAAGGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003102.1-1095s1c1
Sequence:CCGGCGACTTCGGCAACTTCGCGGTCTCGAGACCGCGAAGTTGCCGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003102.1-741s1c1
Sequence:CCGGGCCCAACTCTGACTCGGCGGACTCGAGTCCGCCGAGTCAGAGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003102.2-1155s21c1
Sequence:CCGGGGCCTCCATTTGTACCGAAACCTCGAGGTTTCGGTACAAATGGAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003102.2-875s21c1
Sequence:CCGGGAGCACTCAGAGCGCAAGAAGCTCGAGCTTCTTGCGCTCTGAGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003102.2-336s21c1
Sequence:CCGGAGATCTGGCAGGAGGTCATGCCTCGAGGCATGACCTCCTGCCAGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003102.2-1019s21c1
Sequence:CCGGTGAGGTCTCACCTTCGCCTTTCTCGAGAAAGGCGAAGGTGAGACCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003102
SOD3 MISSION shRNA Lentiviral Transduction Particles
superoxide dismutase 3, extracellular
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003102.1-765s1c1
Sequence:CCGGGATCCGAGACATGTACGCCAACTCGAGTTGGCGTACATGTCTCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003102.1-942s1c1
Sequence:CCGGCGACGCCTTCTTCGCCCTGGACTCGAGTCCAGGGCGAAGAAGGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003102.1-1095s1c1
Sequence:CCGGCGACTTCGGCAACTTCGCGGTCTCGAGACCGCGAAGTTGCCGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003102.1-741s1c1
Sequence:CCGGGCCCAACTCTGACTCGGCGGACTCGAGTCCGCCGAGTCAGAGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003102.2-1155s21c1
Sequence:CCGGGGCCTCCATTTGTACCGAAACCTCGAGGTTTCGGTACAAATGGAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003102.2-875s21c1
Sequence:CCGGGAGCACTCAGAGCGCAAGAAGCTCGAGCTTCTTGCGCTCTGAGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003102.2-336s21c1
Sequence:CCGGAGATCTGGCAGGAGGTCATGCCTCGAGGCATGACCTCCTGCCAGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003102.2-1019s21c1
Sequence:CCGGTGAGGTCTCACCTTCGCCTTTCTCGAGAAAGGCGAAGGTGAGACCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011435
VALIDATED
SOD3 MISSION shRNA Bacterial Glycerol Stock
superoxide dismutase 3, extracellular
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011435.2-971s1c1
Sequence:CCGGCCAGACAAAGGAGCGCAAGAACTCGAGTTCTTGCGCTCCTTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011435.2-366s1c1
Sequence:CCGGCTTGACCCGGTTGAGAAGATACTCGAGTATCTTCTCAACCGGGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011435.2-489s1c1
Sequence:CCGGCATGCAATCTGCAGGGTACAACTCGAGTTGTACCCTGCAGATTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011435.2-866s1c1
Sequence:CCGGCGACCTGGGTAAAGGTGGCAACTCGAGTTGCCACCTTTACCCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011435.3-364s21c1
Sequence:CCGGCTTGACCCGGTTGAGAAGATACTCGAGTATCTTCTCAACCGGGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011435.3-487s21c1
Sequence:CCGGCATGCAATCTGCAGGGTACAACTCGAGTTGTACCCTGCAGATTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011435.3-1266s21c1
Sequence:CCGGCACCTTAGTTAACCCAGAAATCTCGAGATTTCTGGGTTAACTAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011435.3-969s21c1
Sequence:CCGGCCAGACAAAGGAGCGCAAGAACTCGAGTTCTTGCGCTCCTTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011435.3-1004s21c1
Sequence:CCGGGCGAGTGCAAGACCACTTAAGCTCGAGCTTAAGTGGTCTTGCACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011435.3-579s21c1
Sequence:CCGGCTCCAGGCTTGAGGCCTATTTCTCGAGAAATAGGCCTCAAGCCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011435
VALIDATED
SOD3 MISSION shRNA shRNA Plasmid DNA
superoxide dismutase 3, extracellular
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011435.2-971s1c1
Sequence:CCGGCCAGACAAAGGAGCGCAAGAACTCGAGTTCTTGCGCTCCTTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011435.2-366s1c1
Sequence:CCGGCTTGACCCGGTTGAGAAGATACTCGAGTATCTTCTCAACCGGGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011435.2-489s1c1
Sequence:CCGGCATGCAATCTGCAGGGTACAACTCGAGTTGTACCCTGCAGATTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011435.2-866s1c1
Sequence:CCGGCGACCTGGGTAAAGGTGGCAACTCGAGTTGCCACCTTTACCCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011435.3-364s21c1
Sequence:CCGGCTTGACCCGGTTGAGAAGATACTCGAGTATCTTCTCAACCGGGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011435.3-487s21c1
Sequence:CCGGCATGCAATCTGCAGGGTACAACTCGAGTTGTACCCTGCAGATTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011435.3-1266s21c1
Sequence:CCGGCACCTTAGTTAACCCAGAAATCTCGAGATTTCTGGGTTAACTAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011435.3-969s21c1
Sequence:CCGGCCAGACAAAGGAGCGCAAGAACTCGAGTTCTTGCGCTCCTTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011435.3-1004s21c1
Sequence:CCGGGCGAGTGCAAGACCACTTAAGCTCGAGCTTAAGTGGTCTTGCACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011435.3-579s21c1
Sequence:CCGGCTCCAGGCTTGAGGCCTATTTCTCGAGAAATAGGCCTCAAGCCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011435
VALIDATED
SOD3 MISSION shRNA Lentiviral Transduction Particles
superoxide dismutase 3, extracellular
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011435.2-971s1c1
Sequence:CCGGCCAGACAAAGGAGCGCAAGAACTCGAGTTCTTGCGCTCCTTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011435.2-366s1c1
Sequence:CCGGCTTGACCCGGTTGAGAAGATACTCGAGTATCTTCTCAACCGGGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011435.2-489s1c1
Sequence:CCGGCATGCAATCTGCAGGGTACAACTCGAGTTGTACCCTGCAGATTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011435.2-866s1c1
Sequence:CCGGCGACCTGGGTAAAGGTGGCAACTCGAGTTGCCACCTTTACCCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011435.3-364s21c1
Sequence:CCGGCTTGACCCGGTTGAGAAGATACTCGAGTATCTTCTCAACCGGGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011435.3-487s21c1
Sequence:CCGGCATGCAATCTGCAGGGTACAACTCGAGTTGTACCCTGCAGATTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011435.3-1266s21c1
Sequence:CCGGCACCTTAGTTAACCCAGAAATCTCGAGATTTCTGGGTTAACTAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011435.3-969s21c1
Sequence:CCGGCCAGACAAAGGAGCGCAAGAACTCGAGTTCTTGCGCTCCTTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011435.3-1004s21c1
Sequence:CCGGGCGAGTGCAAGACCACTTAAGCTCGAGCTTAAGTGGTCTTGCACTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011435.3-579s21c1
Sequence:CCGGCTCCAGGCTTGAGGCCTATTTCTCGAGAAATAGGCCTCAAGCCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks