EMAIL THIS PAGE TO A FRIEND

SOGA1

suppressor of glucose, autophagy associated 1

Synonyms: C20orf117 KIAA0889 SOGA
UniProtKB ID: O94964, A6NK10, Q14DB2, Q5JW51, Q6ZTG8
Gene ID:
Mouse(320706) suppressor of glucose, autophagy associated 1
Rat(311578) suppressor of glucose, autophagy associated 1
Zebrafish(797906) suppressor of glucose, autophagy associated 1
domestic cat(101095408) suppressor of glucose, autophagy associated 1
dog(485860) suppressor of glucose, autophagy associated 1
chicken(419159) suppressor of glucose, autophagy associated 1
cow(508997) suppressor of glucose, autophagy associated 1
sheep(101121620) suppressor of glucose, autophagy associated 1
domestic guinea pig(100735177) suppressor of glucose, autophagy associated 1
naked mole-rat(101710320) suppressor of glucose, autophagy associated 1
94 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001164663 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001164663 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001164663 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_199181 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199181 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199181 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080627 Rosetta Predictions human pricing
NM_199181 Rosetta Predictions human pricing
XM_001067659 Rosetta Predictions rat pricing
XM_230787 Rosetta Predictions rat pricing
XM_283804 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080627 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036436 predicted 2905
2 SASI_Hs01_00036437 predicted 740
3 SASI_Hs01_00036438 predicted 1177
4 SASI_Hs01_00036439 predicted 1932
5 SASI_Hs01_00036440 predicted 1662
6 SASI_Hs01_00036441 predicted 2346
7 SASI_Hs01_00036442 predicted 2399
8 SASI_Hs01_00036443 predicted 2417
9 SASI_Hs01_00036444 predicted 2314
10 SASI_Hs01_00036445 predicted 2030
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079730 predicted 860
2 SASI_Hs01_00079732 predicted 2047
3 SASI_Hs01_00079733 predicted 1773
4 SASI_Hs02_00372623 predicted 2040
5 SASI_Hs02_00372624 predicted 2468
6 SASI_Hs01_00079735 predicted 2518
7 SASI_Hs01_00079736 predicted 2531
8 SASI_Hs02_00372625 predicted 792
9 SASI_Hs02_00372626 predicted 818
10 SASI_Hs02_00372627 predicted 3071
11 SASI_Hs01_00079729 predicted 3033
12 SASI_Hs01_00079731 predicted 1300
13 SASI_Hs01_00079734 predicted 2474
14 SASI_Hs01_00079737 predicted 2433
15 SASI_Hs01_00079738 predicted 2160
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067659 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321752 predicted 949
2 SASI_Rn02_00321753 predicted 3995
3 SASI_Rn02_00321754 predicted 3700
4 SASI_Rn02_00321755 predicted 2140
5 SASI_Rn02_00321756 predicted 1868
6 SASI_Rn02_00321757 predicted 1700
7 SASI_Rn02_00321758 predicted 1238
8 SASI_Rn02_00321759 predicted 4266
9 SASI_Rn02_00321760 predicted 3717
10 SASI_Rn02_00321761 predicted 4382
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230787 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386452 predicted 579
2 SASI_Rn02_00386453 predicted 3554
3 SASI_Rn02_00386454 predicted 1887
4 SASI_Rn02_00386455 predicted 1496
5 SASI_Rn02_00386456 predicted 1330
6 SASI_Rn02_00386457 predicted 867
7 SASI_Rn02_00386458 predicted 4117
8 SASI_Rn02_00386459 predicted 2828
9 SASI_Rn02_00386460 predicted 3559
10 SASI_Rn02_00386461 predicted 4232
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_283804 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246703 predicted 4027
2 SASI_Mm01_00246704 predicted 1616
3 SASI_Mm01_00246705 predicted 2630
4 SASI_Mm01_00246706 predicted 3277
5 SASI_Mm01_00246707 predicted 3832
6 SASI_Mm01_00246708 predicted 4926
7 SASI_Mm01_00246709 predicted 3778
8 SASI_Mm01_00246710 predicted 1038
9 SASI_Mm01_00246711 predicted 3917
10 SASI_Mm01_00246712 predicted 2647
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001164663
VALIDATED
SOGA1 MISSION shRNA Bacterial Glycerol Stock
suppressor of glucose, autophagy associated 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001164663.1-4981s21c1
Sequence:CCGGGCGAGGAAAGCTGCAAGAAACCTCGAGGTTTCTTGCAGCTTTCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367026    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001164663.1-5440s21c1
Sequence:CCGGGAGCTTTCACATTAAGGTAAACTCGAGTTTACCTTAATGTGAAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164663.1-3249s21c1
Sequence:CCGGTGGACCCAGAACACGCCTAATCTCGAGATTAGGCGTGTTCTGGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164663.1-1012s21c1
Sequence:CCGGTGCGTTCCGAGAACGACTATCCTCGAGGATAGTCGTTCTCGGAACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001164663.1-1964s21c1
Sequence:CCGGGCTGAACGAGCTGGCCAAATACTCGAGTATTTGGCCAGCTCGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001164663.1-4248s21c1
Sequence:CCGGAGCCGGTGGCTTTGCAATTTCCTCGAGGAAATTGCAAAGCCACCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164663.1-1087s21c1
Sequence:CCGGACATGGAGGAAGACGTGTATCCTCGAGGATACACGTCTTCCTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164663.1-4810s21c1
Sequence:CCGGATGGGCTTTCTAGCCTCTTTACTCGAGTAAAGAGGCTAGAAAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001164663
VALIDATED
SOGA1 MISSION shRNA shRNA Plasmid DNA
suppressor of glucose, autophagy associated 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001164663.1-4981s21c1
Sequence:CCGGGCGAGGAAAGCTGCAAGAAACCTCGAGGTTTCTTGCAGCTTTCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367026    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001164663.1-5440s21c1
Sequence:CCGGGAGCTTTCACATTAAGGTAAACTCGAGTTTACCTTAATGTGAAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164663.1-3249s21c1
Sequence:CCGGTGGACCCAGAACACGCCTAATCTCGAGATTAGGCGTGTTCTGGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164663.1-1012s21c1
Sequence:CCGGTGCGTTCCGAGAACGACTATCCTCGAGGATAGTCGTTCTCGGAACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001164663.1-1964s21c1
Sequence:CCGGGCTGAACGAGCTGGCCAAATACTCGAGTATTTGGCCAGCTCGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001164663.1-4248s21c1
Sequence:CCGGAGCCGGTGGCTTTGCAATTTCCTCGAGGAAATTGCAAAGCCACCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164663.1-1087s21c1
Sequence:CCGGACATGGAGGAAGACGTGTATCCTCGAGGATACACGTCTTCCTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164663.1-4810s21c1
Sequence:CCGGATGGGCTTTCTAGCCTCTTTACTCGAGTAAAGAGGCTAGAAAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001164663
VALIDATED
SOGA1 MISSION shRNA Lentiviral Transduction Particles
suppressor of glucose, autophagy associated 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001164663.1-4981s21c1
Sequence:CCGGGCGAGGAAAGCTGCAAGAAACCTCGAGGTTTCTTGCAGCTTTCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367026    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001164663.1-5440s21c1
Sequence:CCGGGAGCTTTCACATTAAGGTAAACTCGAGTTTACCTTAATGTGAAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164663.1-3249s21c1
Sequence:CCGGTGGACCCAGAACACGCCTAATCTCGAGATTAGGCGTGTTCTGGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164663.1-1012s21c1
Sequence:CCGGTGCGTTCCGAGAACGACTATCCTCGAGGATAGTCGTTCTCGGAACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001164663.1-1964s21c1
Sequence:CCGGGCTGAACGAGCTGGCCAAATACTCGAGTATTTGGCCAGCTCGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001164663.1-4248s21c1
Sequence:CCGGAGCCGGTGGCTTTGCAATTTCCTCGAGGAAATTGCAAAGCCACCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164663.1-1087s21c1
Sequence:CCGGACATGGAGGAAGACGTGTATCCTCGAGGATACACGTCTTCCTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164663.1-4810s21c1
Sequence:CCGGATGGGCTTTCTAGCCTCTTTACTCGAGTAAAGAGGCTAGAAAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199181
SOGA1 MISSION shRNA Bacterial Glycerol Stock
suppressor of glucose, autophagy associated 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199181.2-2478s1c1
Sequence:CCGGCGCTCAGCATTCTGATAACAACTCGAGTTGTTATCAGAATGCTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199181.2-3030s1c1
Sequence:CCGGCAGTGAGAAGATCCACGACAACTCGAGTTGTCGTGGATCTTCTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199181.2-3055s1c1
Sequence:CCGGGCTGTTTCCGAAGTTGAGCTTCTCGAGAAGCTCAACTTCGGAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199181.2-2467s1c1
Sequence:CCGGGAGGAGATAAACGCTCAGCATCTCGAGATGCTGAGCGTTTATCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199181.2-1042s1c1
Sequence:CCGGGAGATGGACGACATGAAGGATCTCGAGATCCTTCATGTCGTCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199181
SOGA1 MISSION shRNA shRNA Plasmid DNA
suppressor of glucose, autophagy associated 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199181.2-2478s1c1
Sequence:CCGGCGCTCAGCATTCTGATAACAACTCGAGTTGTTATCAGAATGCTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199181.2-3030s1c1
Sequence:CCGGCAGTGAGAAGATCCACGACAACTCGAGTTGTCGTGGATCTTCTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199181.2-3055s1c1
Sequence:CCGGGCTGTTTCCGAAGTTGAGCTTCTCGAGAAGCTCAACTTCGGAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199181.2-2467s1c1
Sequence:CCGGGAGGAGATAAACGCTCAGCATCTCGAGATGCTGAGCGTTTATCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199181.2-1042s1c1
Sequence:CCGGGAGATGGACGACATGAAGGATCTCGAGATCCTTCATGTCGTCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199181
SOGA1 MISSION shRNA Lentiviral Transduction Particles
suppressor of glucose, autophagy associated 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179997    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199181.2-2478s1c1
Sequence:CCGGCGCTCAGCATTCTGATAACAACTCGAGTTGTTATCAGAATGCTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199181.2-3030s1c1
Sequence:CCGGCAGTGAGAAGATCCACGACAACTCGAGTTGTCGTGGATCTTCTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155184    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199181.2-3055s1c1
Sequence:CCGGGCTGTTTCCGAAGTTGAGCTTCTCGAGAAGCTCAACTTCGGAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199181.2-2467s1c1
Sequence:CCGGGAGGAGATAAACGCTCAGCATCTCGAGATGCTGAGCGTTTATCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199181.2-1042s1c1
Sequence:CCGGGAGATGGACGACATGAAGGATCTCGAGATCCTTCATGTCGTCCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks