EMAIL THIS PAGE TO A FRIEND

SOGA2

SOGA family member 2

Synonyms: CCDC165 KIAA0802
UniProtKB ID: Q9Y4B5, E9PAY7, Q6ZMQ9, Q8IWA9
Gene ID:
Mouse(68617) SOGA family member 2
Rat(316764) SOGA family member 2
naked mole-rat(101709035) SOGA family member 2
domestic guinea pig(100713726) SOGA family member 2
sheep(101103445) SOGA family member 2
chicken(426050) SOGA family member 2
domestic cat(101082783) SOGA family member 2
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015210 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015210 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015210 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172963 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172963 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172963 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070191 MISSION® esiRNA esiRNA human KIAA0802 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015210 Rosetta Predictions human pricing
XM_237548 Rosetta Predictions rat pricing
XR_007295 Rosetta Predictions rat pricing
NM_001114098 Rosetta Predictions mouse pricing
NM_172963 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015210 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236041 predicted 2970
2 SASI_Hs01_00236042 predicted 362
3 SASI_Hs02_00347320 predicted 433
4 SASI_Hs01_00236043 predicted 337
5 SASI_Hs01_00236044 predicted 2166
6 SASI_Hs01_00236045 predicted 785
7 SASI_Hs01_00236047 predicted 2981
8 SASI_Hs01_00236048 predicted 1489
9 SASI_Hs01_00236049 predicted 2239
10 SASI_Hs01_00236050 predicted 484
11 SASI_Hs01_00236046 predicted 2298
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237548 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00391009 predicted 6407
2 SASI_Rn02_00391010 predicted 6354
3 SASI_Rn02_00391011 predicted 6349
4 SASI_Rn02_00391012 predicted 6411
5 SASI_Rn02_00391013 predicted 6381
6 SASI_Rn02_00391014 predicted 6372
7 SASI_Rn02_00391015 predicted 6308
8 SASI_Rn02_00391016 predicted 6359
9 SASI_Rn02_00391017 predicted 6229
10 SASI_Rn02_00391018 predicted 6243
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007295 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00414245 predicted 3940
2 SASI_Rn01_00122858 predicted 5851
3 SASI_Rn02_00414246 predicted 3883
4 SASI_Rn01_00122859 predicted 5728
5 SASI_Rn01_00122860 predicted 5904
6 SASI_Rn02_00414247 predicted 5878
7 SASI_Rn01_00122861 predicted 4637
8 SASI_Rn02_00414248 predicted 5722
9 SASI_Rn01_00122863 predicted 5737
10 SASI_Rn01_00122865 predicted 4776
11 SASI_Rn01_00122862 predicted 1341
12 SASI_Rn01_00122864 predicted 1366
13 SASI_Rn01_00122866 predicted 1652
14 SASI_Rn01_00122867 predicted 4639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114098 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308379 predicted 5172
2 SASI_Mm02_00308380 predicted 2157
3 SASI_Mm02_00308381 predicted 2527
4 SASI_Mm02_00308382 predicted 2983
5 SASI_Mm02_00308383 predicted 4231
6 SASI_Mm02_00308384 predicted 3329
7 SASI_Mm02_00308385 predicted 4415
8 SASI_Mm02_00308386 predicted 3490
9 SASI_Mm02_00308387 predicted 3079
10 SASI_Mm02_00308388 predicted 4389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172963 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037383 predicted 6337
2 SASI_Mm01_00037384 predicted 5165
3 SASI_Mm01_00037385 predicted 6333
4 SASI_Mm01_00037386 predicted 2154
5 SASI_Mm01_00037387 predicted 2524
6 SASI_Mm01_00037388 predicted 2977
7 SASI_Mm01_00037389 predicted 4220
8 SASI_Mm01_00037390 predicted 3322
9 SASI_Mm02_00345012 predicted 4410
10 SASI_Mm01_00037391 predicted 3079
11 SASI_Mm01_00037392 predicted 2642
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015210
VALIDATED
SOGA2 MISSION shRNA Bacterial Glycerol Stock
SOGA family member 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015210.1-4278s1c1
Sequence:CCGGCCAAGTTTGAACGCACATGCTCTCGAGAGCATGTGCGTTCAAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015210.1-4753s1c1
Sequence:CCGGGCTGCTGGAACATGCCTTAAACTCGAGTTTAAGGCATGTTCCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167877    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015210.1-5125s1c1
Sequence:CCGGGCATGGATTATCACAGTATAACTCGAGTTATACTGTGATAATCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_015210.3-206s21c1
Sequence:CCGGGAACTGGACCGCGCTAATAAACTCGAGTTTATTAGCGCGGTCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015210.3-361s21c1
Sequence:CCGGCAGATTGCACCACGAACTTAACTCGAGTTAAGTTCGTGGTGCAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015210.3-5116s21c1
Sequence:CCGGTGCAAGCTTGCATGGATTATCCTCGAGGATAATCCATGCAAGCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015210.3-3352s21c1
Sequence:CCGGGTCTGAGTTCCAGCGTCTAATCTCGAGATTAGACGCTGGAACTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015210.3-4442s21c1
Sequence:CCGGCCCGTGCACACCACCATTAATCTCGAGATTAATGGTGGTGTGCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015210
VALIDATED
SOGA2 MISSION shRNA shRNA Plasmid DNA
SOGA family member 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015210.1-4278s1c1
Sequence:CCGGCCAAGTTTGAACGCACATGCTCTCGAGAGCATGTGCGTTCAAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015210.1-4753s1c1
Sequence:CCGGGCTGCTGGAACATGCCTTAAACTCGAGTTTAAGGCATGTTCCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167877    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015210.1-5125s1c1
Sequence:CCGGGCATGGATTATCACAGTATAACTCGAGTTATACTGTGATAATCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_015210.3-206s21c1
Sequence:CCGGGAACTGGACCGCGCTAATAAACTCGAGTTTATTAGCGCGGTCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015210.3-361s21c1
Sequence:CCGGCAGATTGCACCACGAACTTAACTCGAGTTAAGTTCGTGGTGCAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015210.3-5116s21c1
Sequence:CCGGTGCAAGCTTGCATGGATTATCCTCGAGGATAATCCATGCAAGCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015210.3-3352s21c1
Sequence:CCGGGTCTGAGTTCCAGCGTCTAATCTCGAGATTAGACGCTGGAACTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015210.3-4442s21c1
Sequence:CCGGCCCGTGCACACCACCATTAATCTCGAGATTAATGGTGGTGTGCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015210
VALIDATED
SOGA2 MISSION shRNA Lentiviral Transduction Particles
SOGA family member 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015210.1-4278s1c1
Sequence:CCGGCCAAGTTTGAACGCACATGCTCTCGAGAGCATGTGCGTTCAAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015210.1-4753s1c1
Sequence:CCGGGCTGCTGGAACATGCCTTAAACTCGAGTTTAAGGCATGTTCCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167877    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015210.1-5125s1c1
Sequence:CCGGGCATGGATTATCACAGTATAACTCGAGTTATACTGTGATAATCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_015210.3-206s21c1
Sequence:CCGGGAACTGGACCGCGCTAATAAACTCGAGTTTATTAGCGCGGTCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015210.3-361s21c1
Sequence:CCGGCAGATTGCACCACGAACTTAACTCGAGTTAAGTTCGTGGTGCAATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015210.3-5116s21c1
Sequence:CCGGTGCAAGCTTGCATGGATTATCCTCGAGGATAATCCATGCAAGCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015210.3-3352s21c1
Sequence:CCGGGTCTGAGTTCCAGCGTCTAATCTCGAGATTAGACGCTGGAACTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015210.3-4442s21c1
Sequence:CCGGCCCGTGCACACCACCATTAATCTCGAGATTAATGGTGGTGTGCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172963
SOGA2 MISSION shRNA Bacterial Glycerol Stock
SOGA family member 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193062    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172963.3-4519s1c1
Sequence:CCGGCCGGAATAGTTCACTGTAATTCTCGAGAATTACAGTGAACTATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172963.3-240s1c1
Sequence:CCGGGCAGAAGTATAAGTCCCTCTACTCGAGTAGAGGGACTTATACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172963.3-2875s1c1
Sequence:CCGGCCCGACGACTTGAAATACATTCTCGAGAATGTATTTCAAGTCGTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172963.4-6394s21c1
Sequence:CCGGTGAATGTTCAACCTGGTAAACCTCGAGGTTTACCAGGTTGAACATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172963.4-5151s21c1
Sequence:CCGGCCCTCTGAACAGCCTAGATATCTCGAGATATCTAGGCTGTTCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172963.4-3065s21c1
Sequence:CCGGTGGATGGTCTCTCGCCCTTATCTCGAGATAAGGGCGAGAGACCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172963.4-2815s21c1
Sequence:CCGGGAGTGCCTGGTGACCATAAAGCTCGAGCTTTATGGTCACCAGGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172963.4-1875s21c1
Sequence:CCGGCCAGGATGACAGTGCGGATTTCTCGAGAAATCCGCACTGTCATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172963
SOGA2 MISSION shRNA shRNA Plasmid DNA
SOGA family member 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193062    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172963.3-4519s1c1
Sequence:CCGGCCGGAATAGTTCACTGTAATTCTCGAGAATTACAGTGAACTATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172963.3-240s1c1
Sequence:CCGGGCAGAAGTATAAGTCCCTCTACTCGAGTAGAGGGACTTATACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172963.3-2875s1c1
Sequence:CCGGCCCGACGACTTGAAATACATTCTCGAGAATGTATTTCAAGTCGTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172963.4-6394s21c1
Sequence:CCGGTGAATGTTCAACCTGGTAAACCTCGAGGTTTACCAGGTTGAACATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172963.4-5151s21c1
Sequence:CCGGCCCTCTGAACAGCCTAGATATCTCGAGATATCTAGGCTGTTCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172963.4-3065s21c1
Sequence:CCGGTGGATGGTCTCTCGCCCTTATCTCGAGATAAGGGCGAGAGACCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172963.4-2815s21c1
Sequence:CCGGGAGTGCCTGGTGACCATAAAGCTCGAGCTTTATGGTCACCAGGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172963.4-1875s21c1
Sequence:CCGGCCAGGATGACAGTGCGGATTTCTCGAGAAATCCGCACTGTCATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172963
SOGA2 MISSION shRNA Lentiviral Transduction Particles
SOGA family member 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193062    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172963.3-4519s1c1
Sequence:CCGGCCGGAATAGTTCACTGTAATTCTCGAGAATTACAGTGAACTATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172963.3-240s1c1
Sequence:CCGGGCAGAAGTATAAGTCCCTCTACTCGAGTAGAGGGACTTATACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172963.3-2875s1c1
Sequence:CCGGCCCGACGACTTGAAATACATTCTCGAGAATGTATTTCAAGTCGTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172963.4-6394s21c1
Sequence:CCGGTGAATGTTCAACCTGGTAAACCTCGAGGTTTACCAGGTTGAACATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172963.4-5151s21c1
Sequence:CCGGCCCTCTGAACAGCCTAGATATCTCGAGATATCTAGGCTGTTCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172963.4-3065s21c1
Sequence:CCGGTGGATGGTCTCTCGCCCTTATCTCGAGATAAGGGCGAGAGACCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172963.4-2815s21c1
Sequence:CCGGGAGTGCCTGGTGACCATAAAGCTCGAGCTTTATGGTCACCAGGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172963.4-1875s21c1
Sequence:CCGGCCAGGATGACAGTGCGGATTTCTCGAGAAATCCGCACTGTCATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks