EMAIL THIS PAGE TO A FRIEND

SOGA3

SOGA family member 3

Synonyms: C6orf174 dJ403A15.3
UniProtKB ID: Q5TF21
Gene ID:
Mouse(67412) SOGA family member 3
Rat(308053) SOGA family member 3
dog(484118) SOGA family member 3
cow(535392) SOGA family member 3
domestic guinea pig(100731928) SOGA family member 3
naked mole-rat(101698343) SOGA family member 3
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026138 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026138 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026138 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001012279 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012279 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012279 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU101661 MISSION® esiRNA esiRNA human AE000661.1 (esiRNA2) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012279 Rosetta Predictions human pricing
XM_001059656 Rosetta Predictions rat pricing
XM_217724 Rosetta Predictions rat pricing
NM_026138 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012279 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043239 predicted 2809
2 SASI_Hs01_00043240 predicted 1432
3 SASI_Hs01_00043241 predicted 1507
4 SASI_Hs01_00043242 predicted 3003
5 SASI_Hs01_00043243 predicted 1872
6 SASI_Hs01_00043244 predicted 1418
7 SASI_Hs02_00306070 predicted 1678
8 SASI_Hs02_00306071 predicted 1740
9 SASI_Hs01_00043246 predicted 1177
10 SASI_Hs01_00043247 predicted 1956
11 SASI_Hs01_00043245 predicted 2993
12 SASI_Hs01_00043248 predicted 912
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059656 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293860 predicted 4133
2 SASI_Rn02_00293861 predicted 5101
3 SASI_Rn02_00293862 predicted 4194
4 SASI_Rn02_00293863 predicted 4081
5 SASI_Rn02_00293864 predicted 3973
6 SASI_Rn02_00293865 predicted 3349
7 SASI_Rn02_00293866 predicted 4224
8 SASI_Rn02_00293867 predicted 3784
9 SASI_Rn02_00293868 predicted 3430
10 SASI_Rn02_00293869 predicted 1594
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217724 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377327 predicted 4244
2 SASI_Rn02_00377328 predicted 5215
3 SASI_Rn02_00377329 predicted 4309
4 SASI_Rn02_00377330 predicted 4095
5 SASI_Rn02_00377331 predicted 3457
6 SASI_Rn02_00377332 predicted 4340
7 SASI_Rn02_00377333 predicted 3901
8 SASI_Rn02_00377334 predicted 3543
9 SASI_Rn02_00377335 predicted 1599
10 SASI_Rn02_00377336 predicted 1982
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026138 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123754 predicted 1873
2 SASI_Mm01_00123755 predicted 3237
3 SASI_Mm02_00329742 predicted 2315
4 SASI_Mm02_00329743 predicted 2027
5 SASI_Mm01_00123757 predicted 2180
6 SASI_Mm02_00329744 predicted 1860
7 SASI_Mm01_00123758 predicted 3259
8 SASI_Mm01_00123760 predicted 2397
9 SASI_Mm01_00123761 predicted 1804
10 SASI_Mm02_00329745 predicted 1613
11 SASI_Mm01_00123753 predicted 3456
12 SASI_Mm01_00123756 predicted 2356
13 SASI_Mm01_00123759 predicted 2135
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026138
SOGA3 MISSION shRNA Bacterial Glycerol Stock
SOGA family member 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026138.2-3056s21c1
Sequence:CCGGGCACGCATCTACGTGGCTAATCTCGAGATTAGCCACGTAGATGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026138.2-2107s21c1
Sequence:CCGGGTGCCAGCTACAGTTCGTTAACTCGAGTTAACGAACTGTAGCTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026138.2-3261s21c1
Sequence:CCGGAGATGTTCCAGCCCATCATTCCTCGAGGAATGATGGGCTGGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216188    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026138.2-3545s1c1
Sequence:CCGGCTCATCTTACACTGTCAAATTCTCGAGAATTTGACAGTGTAAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215379    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026138.2-3734s1c1
Sequence:CCGGCTGTAGGAATTGAGTATTATTCTCGAGAATAATACTCAATTCCTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026138.2-3711s21c1
Sequence:CCGGATGGACAAAGTCTCATAATTACTCGAGTAATTATGAGACTTTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026138.1-2000s1c1
Sequence:CCGGGCAGGATCTCAAGGTTGCAAACTCGAGTTTGCAACCTTGAGATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026138.1-2557s1c1
Sequence:CCGGGCGAAGACTTCAATGGCTCTTCTCGAGAAGAGCCATTGAAGTCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026138
SOGA3 MISSION shRNA shRNA Plasmid DNA
SOGA family member 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026138.2-3056s21c1
Sequence:CCGGGCACGCATCTACGTGGCTAATCTCGAGATTAGCCACGTAGATGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026138.2-2107s21c1
Sequence:CCGGGTGCCAGCTACAGTTCGTTAACTCGAGTTAACGAACTGTAGCTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026138.2-3261s21c1
Sequence:CCGGAGATGTTCCAGCCCATCATTCCTCGAGGAATGATGGGCTGGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216188    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026138.2-3545s1c1
Sequence:CCGGCTCATCTTACACTGTCAAATTCTCGAGAATTTGACAGTGTAAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215379    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026138.2-3734s1c1
Sequence:CCGGCTGTAGGAATTGAGTATTATTCTCGAGAATAATACTCAATTCCTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026138.2-3711s21c1
Sequence:CCGGATGGACAAAGTCTCATAATTACTCGAGTAATTATGAGACTTTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026138.1-2000s1c1
Sequence:CCGGGCAGGATCTCAAGGTTGCAAACTCGAGTTTGCAACCTTGAGATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026138.1-2557s1c1
Sequence:CCGGGCGAAGACTTCAATGGCTCTTCTCGAGAAGAGCCATTGAAGTCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026138
SOGA3 MISSION shRNA Lentiviral Transduction Particles
SOGA family member 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026138.2-3056s21c1
Sequence:CCGGGCACGCATCTACGTGGCTAATCTCGAGATTAGCCACGTAGATGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026138.2-2107s21c1
Sequence:CCGGGTGCCAGCTACAGTTCGTTAACTCGAGTTAACGAACTGTAGCTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026138.2-3261s21c1
Sequence:CCGGAGATGTTCCAGCCCATCATTCCTCGAGGAATGATGGGCTGGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216188    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026138.2-3545s1c1
Sequence:CCGGCTCATCTTACACTGTCAAATTCTCGAGAATTTGACAGTGTAAGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215379    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026138.2-3734s1c1
Sequence:CCGGCTGTAGGAATTGAGTATTATTCTCGAGAATAATACTCAATTCCTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026138.2-3711s21c1
Sequence:CCGGATGGACAAAGTCTCATAATTACTCGAGTAATTATGAGACTTTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026138.1-2000s1c1
Sequence:CCGGGCAGGATCTCAAGGTTGCAAACTCGAGTTTGCAACCTTGAGATCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026138.1-2557s1c1
Sequence:CCGGGCGAAGACTTCAATGGCTCTTCTCGAGAAGAGCCATTGAAGTCTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012279
VALIDATED
SOGA3 MISSION shRNA Bacterial Glycerol Stock
SOGA family member 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012279.1-1694s1c1
Sequence:CCGGGCCGCTTTGATGAGAAAGAAACTCGAGTTTCTTTCTCATCAAAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001012279.1-2815s1c1
Sequence:CCGGGAGTCAGATGTTCCAGCCTATCTCGAGATAGGCTGGAACATCTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012279.1-2116s1c1
Sequence:CCGGGCTCAACAAGTACAAGTACAACTCGAGTTGTACTTGTACTTGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012279.1-1532s1c1
Sequence:CCGGGCAAAGCAAGCTTTACAGAATCTCGAGATTCTGTAAAGCTTGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012279.1-1590s1c1
Sequence:CCGGGAGGAAGCAAAGATTTGCCAACTCGAGTTGGCAAATCTTTGCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001012279.1-3148s1c1
Sequence:CCGGGCAAGTGAGACTGCTTCAAATCTCGAGATTTGAAGCAGTCTCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012279.1-2806s1c1
Sequence:CCGGCATTTCCGTGAGTCAGATGTTCTCGAGAACATCTGACTCACGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012279.1-3280s1c1
Sequence:CCGGCACAGAGACTAACTGGCATAACTCGAGTTATGCCAGTTAGTCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001012279.1-865s1c1
Sequence:CCGGCATCCAGTTCCATCTCAAGAACTCGAGTTCTTGAGATGGAACTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012279
VALIDATED
SOGA3 MISSION shRNA shRNA Plasmid DNA
SOGA family member 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012279.1-1694s1c1
Sequence:CCGGGCCGCTTTGATGAGAAAGAAACTCGAGTTTCTTTCTCATCAAAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001012279.1-2815s1c1
Sequence:CCGGGAGTCAGATGTTCCAGCCTATCTCGAGATAGGCTGGAACATCTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012279.1-2116s1c1
Sequence:CCGGGCTCAACAAGTACAAGTACAACTCGAGTTGTACTTGTACTTGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012279.1-1532s1c1
Sequence:CCGGGCAAAGCAAGCTTTACAGAATCTCGAGATTCTGTAAAGCTTGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012279.1-1590s1c1
Sequence:CCGGGAGGAAGCAAAGATTTGCCAACTCGAGTTGGCAAATCTTTGCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001012279.1-3148s1c1
Sequence:CCGGGCAAGTGAGACTGCTTCAAATCTCGAGATTTGAAGCAGTCTCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012279.1-2806s1c1
Sequence:CCGGCATTTCCGTGAGTCAGATGTTCTCGAGAACATCTGACTCACGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012279.1-3280s1c1
Sequence:CCGGCACAGAGACTAACTGGCATAACTCGAGTTATGCCAGTTAGTCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001012279.1-865s1c1
Sequence:CCGGCATCCAGTTCCATCTCAAGAACTCGAGTTCTTGAGATGGAACTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012279
VALIDATED
SOGA3 MISSION shRNA Lentiviral Transduction Particles
SOGA family member 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012279.1-1694s1c1
Sequence:CCGGGCCGCTTTGATGAGAAAGAAACTCGAGTTTCTTTCTCATCAAAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001012279.1-2815s1c1
Sequence:CCGGGAGTCAGATGTTCCAGCCTATCTCGAGATAGGCTGGAACATCTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012279.1-2116s1c1
Sequence:CCGGGCTCAACAAGTACAAGTACAACTCGAGTTGTACTTGTACTTGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012279.1-1532s1c1
Sequence:CCGGGCAAAGCAAGCTTTACAGAATCTCGAGATTCTGTAAAGCTTGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012279.1-1590s1c1
Sequence:CCGGGAGGAAGCAAAGATTTGCCAACTCGAGTTGGCAAATCTTTGCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128814    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001012279.1-3148s1c1
Sequence:CCGGGCAAGTGAGACTGCTTCAAATCTCGAGATTTGAAGCAGTCTCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012279.1-2806s1c1
Sequence:CCGGCATTTCCGTGAGTCAGATGTTCTCGAGAACATCTGACTCACGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129239    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012279.1-3280s1c1
Sequence:CCGGCACAGAGACTAACTGGCATAACTCGAGTTATGCCAGTTAGTCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001012279.1-865s1c1
Sequence:CCGGCATCCAGTTCCATCTCAAGAACTCGAGTTCTTGAGATGGAACTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks