EMAIL THIS PAGE TO A FRIEND

SOHLH1

spermatogenesis and oogenesis specific basic helix-loop-helix 1

Synonyms: C9orf157 NOHLH SPATA27 TEB2 bA100C15.3 bHLHe80
UniProtKB ID: Q5JUK2, C9JG81, Q5EE14, Q5EGC2, Q8NEE3
Gene ID:
Mouse(227631) spermatogenesis and oogenesis specific basic helix-loop-helix 1
Rat(362085) spermatogenesis and oogenesis specific basic helix-loop-helix 1
domestic cat(101091161) spermatogenesis and oogenesis specific basic helix-loop-helix 1
dog(607714) spermatogenesis and oogenesis specific basic helix-loop-helix 1
naked mole-rat(101723233) spermatogenesis and oogenesis specific basic helix-loop-helix 1
domestic guinea pig(101788163) spermatogenesis and oogenesis specific basic helix-loop-helix 1
cow(526069) spermatogenesis and oogenesis specific basic helix-loop-helix 1
121 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_378089 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_378089 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_378089 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001714 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001714 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001714 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012415 Rosetta Predictions human pricing
NM_001101677 Rosetta Predictions human pricing
XM_001078103 Rosetta Predictions rat pricing
XM_342386 Rosetta Predictions rat pricing
NM_001001714 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306110 predicted 448
2 SASI_Hs01_00172678 predicted 469
3 SASI_Hs01_00172680 predicted 435
4 SASI_Hs01_00172681 predicted 458
5 SASI_Hs01_00172682 predicted 538
6 SASI_Hs02_00306111 predicted 460
7 SASI_Hs02_00306112 predicted 384
8 SASI_Hs02_00306113 predicted 397
9 SASI_Hs02_00306114 predicted 385
10 SASI_Hs02_00306115 predicted 654
11 SASI_Hs01_00172676 predicted 1245
12 SASI_Hs01_00172677 predicted 1421
13 SASI_Hs01_00172679 predicted 1337
14 SASI_Hs01_00172683 predicted 1335
15 SASI_Hs01_00172684 predicted 1313
16 SASI_Hs01_00172685 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101677 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322943 predicted 456
2 SASI_Hs02_00322944 predicted 466
3 SASI_Hs02_00322945 predicted 431
4 SASI_Hs02_00322946 predicted 463
5 SASI_Hs02_00322947 predicted 541
6 SASI_Hs02_00322948 predicted 463
7 SASI_Hs02_00322949 predicted 378
8 SASI_Hs02_00322950 predicted 391
9 SASI_Hs02_00322951 predicted 381
10 SASI_Hs02_00322952 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078103 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359665 predicted 631
2 SASI_Rn02_00359666 predicted 486
3 SASI_Rn02_00359667 predicted 723
4 SASI_Rn02_00359668 predicted 800
5 SASI_Rn02_00359669 predicted 448
6 SASI_Rn02_00359670 predicted 277
7 SASI_Rn02_00359671 predicted 401
8 SASI_Rn02_00359672 predicted 213
9 SASI_Rn02_00359673 predicted 421
10 SASI_Rn02_00359674 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342386 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394197 predicted 629
2 SASI_Rn02_00394198 predicted 483
3 SASI_Rn02_00394199 predicted 721
4 SASI_Rn02_00394200 predicted 797
5 SASI_Rn02_00394201 predicted 450
6 SASI_Rn02_00394202 predicted 410
7 SASI_Rn02_00394203 predicted 445
8 SASI_Rn02_00394204 predicted 487
9 SASI_Rn02_00394205 predicted 425
10 SASI_Rn02_00394206 predicted 542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001714 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126343 predicted 322
2 SASI_Mm01_00126344 predicted 500
3 SASI_Mm02_00286191 predicted 482
4 SASI_Mm01_00126345 predicted 451
5 SASI_Mm01_00126346 predicted 800
6 SASI_Mm01_00126347 predicted 216
7 SASI_Mm01_00126348 predicted 731
8 SASI_Mm01_00126349 predicted 280
9 SASI_Mm01_00126350 predicted 472
10 SASI_Mm01_00126351 predicted 615
11 SASI_Mm01_00126352 predicted 817
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_378089
SOHLH1 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis and oogenesis specific basic helix-loop-helix 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378089.1-567s1c1
Sequence:CCGGCAAGGAAATGTGGCACTCGTTCTCGAGAACGAGTGCCACATTTCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378089.1-689s1c1
Sequence:CCGGAGGCGTTTCTGGAAAGTCCTTCTCGAGAAGGACTTTCCAGAAACGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378089.1-117s1c1
Sequence:CCGGGCTCCGCAGCTGCGAGTTCATCTCGAGATGAACTCGCAGCTGCGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378089.1-476s1c1
Sequence:CCGGACGCTGTGAGTTGTAAGGGTACTCGAGTACCCTTACAACTCACAGCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378089.1-606s1c1
Sequence:CCGGGTTGACGTTGTCGAGTCAGATCTCGAGATCTGACTCGACAACGTCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_378089
SOHLH1 MISSION shRNA shRNA Plasmid DNA
spermatogenesis and oogenesis specific basic helix-loop-helix 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378089.1-567s1c1
Sequence:CCGGCAAGGAAATGTGGCACTCGTTCTCGAGAACGAGTGCCACATTTCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378089.1-689s1c1
Sequence:CCGGAGGCGTTTCTGGAAAGTCCTTCTCGAGAAGGACTTTCCAGAAACGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378089.1-117s1c1
Sequence:CCGGGCTCCGCAGCTGCGAGTTCATCTCGAGATGAACTCGCAGCTGCGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378089.1-476s1c1
Sequence:CCGGACGCTGTGAGTTGTAAGGGTACTCGAGTACCCTTACAACTCACAGCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378089.1-606s1c1
Sequence:CCGGGTTGACGTTGTCGAGTCAGATCTCGAGATCTGACTCGACAACGTCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_378089
SOHLH1 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis and oogenesis specific basic helix-loop-helix 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378089.1-567s1c1
Sequence:CCGGCAAGGAAATGTGGCACTCGTTCTCGAGAACGAGTGCCACATTTCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378089.1-689s1c1
Sequence:CCGGAGGCGTTTCTGGAAAGTCCTTCTCGAGAAGGACTTTCCAGAAACGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378089.1-117s1c1
Sequence:CCGGGCTCCGCAGCTGCGAGTTCATCTCGAGATGAACTCGCAGCTGCGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378089.1-476s1c1
Sequence:CCGGACGCTGTGAGTTGTAAGGGTACTCGAGTACCCTTACAACTCACAGCGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_378089.1-606s1c1
Sequence:CCGGGTTGACGTTGTCGAGTCAGATCTCGAGATCTGACTCGACAACGTCAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001714
SOHLH1 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis and oogenesis specific basic helix-loop-helix 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001714.1-1098s1c1
Sequence:CCGGGACAGCATCTTCCCTGACTTTCTCGAGAAAGTCAGGGAAGATGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001714.1-729s1c1
Sequence:CCGGGCAAGTGACATTGTTCCTGGTCTCGAGACCAGGAACAATGTCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001714.1-335s1c1
Sequence:CCGGCCTGGAGATGTCTGTGTACTTCTCGAGAAGTACACAGACATCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001714.1-641s1c1
Sequence:CCGGGTTGTCATTCAGTGAGCCAGACTCGAGTCTGGCTCACTGAATGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001714.1-646s1c1
Sequence:CCGGCATTCAGTGAGCCAGAGTCTTCTCGAGAAGACTCTGGCTCACTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001714.1-158s1c1
Sequence:CCGGCTCATCACAAAGCTCAGCTCTCTCGAGAGAGCTGAGCTTTGTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001714
SOHLH1 MISSION shRNA shRNA Plasmid DNA
spermatogenesis and oogenesis specific basic helix-loop-helix 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001714.1-1098s1c1
Sequence:CCGGGACAGCATCTTCCCTGACTTTCTCGAGAAAGTCAGGGAAGATGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001714.1-729s1c1
Sequence:CCGGGCAAGTGACATTGTTCCTGGTCTCGAGACCAGGAACAATGTCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001714.1-335s1c1
Sequence:CCGGCCTGGAGATGTCTGTGTACTTCTCGAGAAGTACACAGACATCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001714.1-641s1c1
Sequence:CCGGGTTGTCATTCAGTGAGCCAGACTCGAGTCTGGCTCACTGAATGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001714.1-646s1c1
Sequence:CCGGCATTCAGTGAGCCAGAGTCTTCTCGAGAAGACTCTGGCTCACTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001714.1-158s1c1
Sequence:CCGGCTCATCACAAAGCTCAGCTCTCTCGAGAGAGCTGAGCTTTGTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001714
SOHLH1 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis and oogenesis specific basic helix-loop-helix 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001714.1-1098s1c1
Sequence:CCGGGACAGCATCTTCCCTGACTTTCTCGAGAAAGTCAGGGAAGATGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001714.1-729s1c1
Sequence:CCGGGCAAGTGACATTGTTCCTGGTCTCGAGACCAGGAACAATGTCACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001714.1-335s1c1
Sequence:CCGGCCTGGAGATGTCTGTGTACTTCTCGAGAAGTACACAGACATCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001714.1-641s1c1
Sequence:CCGGGTTGTCATTCAGTGAGCCAGACTCGAGTCTGGCTCACTGAATGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001714.1-646s1c1
Sequence:CCGGCATTCAGTGAGCCAGAGTCTTCTCGAGAAGACTCTGGCTCACTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001714.1-158s1c1
Sequence:CCGGCTCATCACAAAGCTCAGCTCTCTCGAGAGAGCTGAGCTTTGTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks