EMAIL THIS PAGE TO A FRIEND

SOHLH2

spermatogenesis and oogenesis specific basic helix-loop-helix 2

Synonyms: SPATA28 TEB1 bHLHe81
UniProtKB ID: Q9NX45, B4DX90, Q5EGC3, Q8TC74, Q96QX4
Gene ID:
Mouse(74434) spermatogenesis and oogenesis specific basic helix-loop-helix 2
Rat(619575) spermatogenesis and oogenesis specific basic helix-loop-helix 2
cow(518810) spermatogenesis and oogenesis specific basic helix-loop-helix 2
sheep(101106086) spermatogenesis and oogenesis specific basic helix-loop-helix 2
domestic guinea pig(100715922) spermatogenesis and oogenesis specific basic helix-loop-helix 2
naked mole-rat(101721741) spermatogenesis and oogenesis specific basic helix-loop-helix 2
dog(486009) spermatogenesis and oogenesis specific basic helix-loop-helix 2
domestic cat(101084762) spermatogenesis and oogenesis specific basic helix-loop-helix 2
114 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028937 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028937 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028937 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017826 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017826 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017826 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017826 Rosetta Predictions human pricing
NM_001034961 Rosetta Predictions rat pricing
NM_028937 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017826 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217646 predicted 531
2 SASI_Hs01_00217647 predicted 1089
3 SASI_Hs01_00217648 predicted 1150
4 SASI_Hs01_00217649 predicted 1130
5 SASI_Hs01_00217650 predicted 535
6 SASI_Hs01_00217651 predicted 348
7 SASI_Hs01_00217652 predicted 1030
8 SASI_Hs01_00217653 predicted 584
9 SASI_Hs01_00217654 predicted 1148
10 SASI_Hs01_00217655 predicted 1239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034961 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037860 predicted 215
2 SASI_Rn01_00037861 predicted 1471
3 SASI_Rn01_00037862 predicted 361
4 SASI_Rn01_00037863 predicted 972
5 SASI_Rn01_00037865 predicted 559
6 SASI_Rn01_00037866 predicted 214
7 SASI_Rn01_00037867 predicted 439
8 SASI_Rn01_00037868 predicted 1041
9 SASI_Rn01_00037869 predicted 1498
10 SASI_Rn02_00204151 predicted 375
11 SASI_Rn01_00037864 predicted 1330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028937 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177181 predicted 1040
2 SASI_Mm01_00177182 predicted 506
3 SASI_Mm01_00177183 predicted 367
4 SASI_Mm01_00177184 predicted 1462
5 SASI_Mm01_00177185 predicted 198
6 SASI_Mm01_00177186 predicted 330
7 SASI_Mm01_00177187 predicted 435
8 SASI_Mm01_00177188 predicted 1175
9 SASI_Mm01_00177189 predicted 323
10 SASI_Mm01_00177190 predicted 1446
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028937
SOHLH2 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis and oogenesis specific basic helix-loop-helix 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028937.1-335s1c1
Sequence:CCGGCCTGAAAGACTTAAAGGCTATCTCGAGATAGCCTTTAAGTCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028937.1-1046s1c1
Sequence:CCGGAGCTCTATTGAGGATCTGTATCTCGAGATACAGATCCTCAATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028937.1-563s1c1
Sequence:CCGGCTGAAGAATGACGCTAGACTTCTCGAGAAGTCTAGCGTCATTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028937.1-209s1c1
Sequence:CCGGGCTAACTCGTTTGACATAATTCTCGAGAATTATGTCAAACGAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028937.1-1465s1c1
Sequence:CCGGGCCTGAAGTTAGCTTTATTAACTCGAGTTAATAAAGCTAACTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028937.3-1511s21c1
Sequence:CCGGACGTTGTAAGAATGGGCTAAACTCGAGTTTAGCCCATTCTTACAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028937
SOHLH2 MISSION shRNA shRNA Plasmid DNA
spermatogenesis and oogenesis specific basic helix-loop-helix 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028937.1-335s1c1
Sequence:CCGGCCTGAAAGACTTAAAGGCTATCTCGAGATAGCCTTTAAGTCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028937.1-1046s1c1
Sequence:CCGGAGCTCTATTGAGGATCTGTATCTCGAGATACAGATCCTCAATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028937.1-563s1c1
Sequence:CCGGCTGAAGAATGACGCTAGACTTCTCGAGAAGTCTAGCGTCATTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028937.1-209s1c1
Sequence:CCGGGCTAACTCGTTTGACATAATTCTCGAGAATTATGTCAAACGAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028937.1-1465s1c1
Sequence:CCGGGCCTGAAGTTAGCTTTATTAACTCGAGTTAATAAAGCTAACTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028937.3-1511s21c1
Sequence:CCGGACGTTGTAAGAATGGGCTAAACTCGAGTTTAGCCCATTCTTACAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028937
SOHLH2 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis and oogenesis specific basic helix-loop-helix 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028937.1-335s1c1
Sequence:CCGGCCTGAAAGACTTAAAGGCTATCTCGAGATAGCCTTTAAGTCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028937.1-1046s1c1
Sequence:CCGGAGCTCTATTGAGGATCTGTATCTCGAGATACAGATCCTCAATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028937.1-563s1c1
Sequence:CCGGCTGAAGAATGACGCTAGACTTCTCGAGAAGTCTAGCGTCATTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028937.1-209s1c1
Sequence:CCGGGCTAACTCGTTTGACATAATTCTCGAGAATTATGTCAAACGAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028937.1-1465s1c1
Sequence:CCGGGCCTGAAGTTAGCTTTATTAACTCGAGTTAATAAAGCTAACTTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028937.3-1511s21c1
Sequence:CCGGACGTTGTAAGAATGGGCTAAACTCGAGTTTAGCCCATTCTTACAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017826
SOHLH2 MISSION shRNA Bacterial Glycerol Stock
spermatogenesis and oogenesis specific basic helix-loop-helix 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017826.1-1095s1c1
Sequence:CCGGCCTTGCATACTGTCAGATATTCTCGAGAATATCTGACAGTATGCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017826.1-686s1c1
Sequence:CCGGCGTACTCTCTTGCCGTATGTACTCGAGTACATACGGCAAGAGAGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017826.1-1134s1c1
Sequence:CCGGCCTACGATGCAACTGCTGTAACTCGAGTTACAGCAGTTGCATCGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017826.1-106s1c1
Sequence:CCGGCCTGGCTGATACTGTACAGAACTCGAGTTCTGTACAGTATCAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017826.1-571s1c1
Sequence:CCGGGCTTGAATTAAATGCTTCGTTCTCGAGAACGAAGCATTTAATTCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017826.2-1010s21c1
Sequence:CCGGGCTCCAATTCCTGACTAATACCTCGAGGTATTAGTCAGGAATTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017826
SOHLH2 MISSION shRNA shRNA Plasmid DNA
spermatogenesis and oogenesis specific basic helix-loop-helix 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017826.1-1095s1c1
Sequence:CCGGCCTTGCATACTGTCAGATATTCTCGAGAATATCTGACAGTATGCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017826.1-686s1c1
Sequence:CCGGCGTACTCTCTTGCCGTATGTACTCGAGTACATACGGCAAGAGAGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017826.1-1134s1c1
Sequence:CCGGCCTACGATGCAACTGCTGTAACTCGAGTTACAGCAGTTGCATCGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017826.1-106s1c1
Sequence:CCGGCCTGGCTGATACTGTACAGAACTCGAGTTCTGTACAGTATCAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017826.1-571s1c1
Sequence:CCGGGCTTGAATTAAATGCTTCGTTCTCGAGAACGAAGCATTTAATTCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017826.2-1010s21c1
Sequence:CCGGGCTCCAATTCCTGACTAATACCTCGAGGTATTAGTCAGGAATTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017826
SOHLH2 MISSION shRNA Lentiviral Transduction Particles
spermatogenesis and oogenesis specific basic helix-loop-helix 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017826.1-1095s1c1
Sequence:CCGGCCTTGCATACTGTCAGATATTCTCGAGAATATCTGACAGTATGCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017826.1-686s1c1
Sequence:CCGGCGTACTCTCTTGCCGTATGTACTCGAGTACATACGGCAAGAGAGTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017826.1-1134s1c1
Sequence:CCGGCCTACGATGCAACTGCTGTAACTCGAGTTACAGCAGTTGCATCGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017826.1-106s1c1
Sequence:CCGGCCTGGCTGATACTGTACAGAACTCGAGTTCTGTACAGTATCAGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017826.1-571s1c1
Sequence:CCGGGCTTGAATTAAATGCTTCGTTCTCGAGAACGAAGCATTTAATTCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017826.2-1010s21c1
Sequence:CCGGGCTCCAATTCCTGACTAATACCTCGAGGTATTAGTCAGGAATTGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks