EMAIL THIS PAGE TO A FRIEND

SON

SON DNA binding protein

Synonyms: BASS1 C21orf50 DBP-5 NREBP SON3
Gene ID:
Human(6651) Summary: This gene encodes a protein that contains multiple simple repeats. The encoded protein binds RNA and promotes pre-mRNA splicing, particularly of transcripts with poor splice sites. The protein also recognizes a specific DNA sequence found in the human hepatitis B virus (HBV) and represses HBV core promoter activity. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Mouse(20658) Son DNA binding protein
Rat(304092) Son DNA binding protein
chicken(770637) SON DNA binding protein
domestic cat(101089540) SON DNA binding protein
dog(478406) SON DNA binding protein
domestic guinea pig(100729133) SON DNA binding protein
naked mole-rat(101696946) SON DNA binding protein
Domestic Rabbit(100328812) SON DNA binding protein
cow(516462) SON DNA binding protein
sheep(101121305) SON DNA binding protein
283 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019973 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019973 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019973 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138927 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138927 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138927 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_003103 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003103 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003103 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003103 Rosetta Predictions human pricing
NM_032195 Rosetta Predictions human pricing
NM_058183 Rosetta Predictions human pricing
NM_138925 Rosetta Predictions human pricing
NM_138926 Rosetta Predictions human pricing
NM_138927 Rosetta Predictions human pricing
XM_001068992 Rosetta Predictions rat pricing
XM_001069321 Rosetta Predictions rat pricing
XM_221656 Rosetta Predictions rat pricing
NM_019973 Rosetta Predictions mouse pricing
NM_178880 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003103 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105057 predicted 1549
2 SASI_Hs01_00105058 predicted 806
3 SASI_Hs01_00105059 predicted 3302
4 SASI_Hs01_00105060 predicted 4329
5 SASI_Hs01_00105061 predicted 5186
6 SASI_Hs01_00105062 predicted 688
7 SASI_Hs01_00105063 predicted 5094
8 SASI_Hs01_00105064 predicted 4907
9 SASI_Hs01_00105065 predicted 3777
10 SASI_Hs01_00105066 predicted 822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182940 predicted 1547
2 SASI_Hs02_00359488 predicted 4901
3 SASI_Hs01_00182941 predicted 798
4 SASI_Hs01_00182942 predicted 3414
5 SASI_Hs02_00359489 predicted 6482
6 SASI_Hs02_00359490 predicted 2606
7 SASI_Hs01_00182947 predicted 5018
8 SASI_Hs02_00359491 predicted 2656
9 SASI_Hs02_00359492 predicted 4859
10 SASI_Hs01_00182949 predicted 815
11 SASI_Hs01_00182943 predicted 4443
12 SASI_Hs01_00182944 predicted 5304
13 SASI_Hs01_00182945 predicted 691
14 SASI_Hs01_00182946 predicted 5217
15 SASI_Hs01_00182948 predicted 3896
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058183 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200547 predicted 1552
2 SASI_Hs01_00200548 predicted 802
3 SASI_Hs01_00200549 predicted 3425
4 SASI_Hs01_00200550 predicted 4448
5 SASI_Hs01_00200551 predicted 5298
6 SASI_Hs01_00200552 predicted 682
7 SASI_Hs01_00200553 predicted 5211
8 SASI_Hs01_00200554 predicted 5026
9 SASI_Hs01_00200555 predicted 3888
10 SASI_Hs01_00200556 predicted 826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084308 predicted 1546
2 SASI_Hs01_00084309 predicted 798
3 SASI_Hs01_00084310 predicted 2468
4 SASI_Hs01_00084311 predicted 3486
5 SASI_Hs01_00084312 predicted 4348
6 SASI_Hs01_00084313 predicted 691
7 SASI_Hs01_00084314 predicted 4263
8 SASI_Hs01_00084315 predicted 4075
9 SASI_Hs01_00084316 predicted 2938
10 SASI_Hs01_00084317 predicted 824
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016365 predicted 1545
2 SASI_Hs01_00016366 predicted 803
3 SASI_Hs01_00016367 predicted 3421
4 SASI_Hs01_00016368 predicted 4443
5 SASI_Hs01_00016369 predicted 5297
6 SASI_Hs01_00016370 predicted 690
7 SASI_Hs01_00016371 predicted 5218
8 SASI_Hs01_00016372 predicted 5029
9 SASI_Hs01_00016373 predicted 3894
10 SASI_Hs01_00016374 predicted 824
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151312 predicted 1543
2 SASI_Hs02_00363994 predicted 4897
3 SASI_Hs01_00151313 predicted 793
4 SASI_Hs01_00151314 predicted 3422
5 SASI_Hs02_00363995 predicted 6479
6 SASI_Hs02_00363996 predicted 2607
7 SASI_Hs01_00151319 predicted 5026
8 SASI_Hs02_00363997 predicted 2654
9 SASI_Hs02_00363998 predicted 4861
10 SASI_Hs01_00151321 predicted 819
11 SASI_Hs01_00151315 predicted 4440
12 SASI_Hs01_00151316 predicted 5307
13 SASI_Hs01_00151317 predicted 691
14 SASI_Hs01_00151318 predicted 5219
15 SASI_Hs01_00151320 predicted 3896
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068992 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00326511 predicted 5011
2 SASI_Rn02_00326512 predicted 2447
3 SASI_Rn02_00326513 predicted 4748
4 SASI_Rn02_00326514 predicted 6188
5 SASI_Rn02_00326515 predicted 3054
6 SASI_Rn02_00326516 predicted 967
7 SASI_Rn02_00326517 predicted 2800
8 SASI_Rn02_00326518 predicted 4128
9 SASI_Rn02_00326519 predicted 2998
10 SASI_Rn02_00326520 predicted 3060
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069321 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00327611 predicted 5025
2 SASI_Rn02_00327612 predicted 2548
3 SASI_Rn02_00327613 predicted 4766
4 SASI_Rn02_00327614 predicted 7281
5 SASI_Rn02_00327615 predicted 3149
6 SASI_Rn02_00327616 predicted 966
7 SASI_Rn02_00327617 predicted 2904
8 SASI_Rn02_00327618 predicted 3106
9 SASI_Rn02_00327619 predicted 3162
10 SASI_Rn02_00327620 predicted 7353
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221656 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380261 predicted 5023
2 SASI_Rn02_00380262 predicted 2544
3 SASI_Rn02_00380263 predicted 4761
4 SASI_Rn02_00380264 predicted 7278
5 SASI_Rn02_00380265 predicted 3154
6 SASI_Rn02_00380266 predicted 967
7 SASI_Rn02_00380267 predicted 2897
8 SASI_Rn02_00380268 predicted 3100
9 SASI_Rn02_00380269 predicted 7360
10 SASI_Rn02_00380270 predicted 3740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019973 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021915 predicted 2771
2 SASI_Mm01_00021916 predicted 4009
3 SASI_Mm01_00021917 predicted 3247
4 SASI_Mm01_00021919 predicted 836
5 SASI_Mm01_00021920 predicted 3157
6 SASI_Mm02_00325276 predicted 2829
7 SASI_Mm01_00021921 predicted 3075
8 SASI_Mm01_00021922 predicted 2899
9 SASI_Mm01_00021923 predicted 3109
10 SASI_Mm02_00325277 predicted 3166
11 SASI_Mm01_00021914 predicted 2154
12 SASI_Mm01_00021918 predicted 2895
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178880 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166841 predicted 2774
2 SASI_Mm01_00166842 predicted 4014
3 SASI_Mm01_00166843 predicted 3240
4 SASI_Mm01_00166845 predicted 842
5 SASI_Mm01_00166846 predicted 3158
6 SASI_Mm02_00349465 predicted 2831
7 SASI_Mm01_00166848 predicted 3083
8 SASI_Mm01_00166849 predicted 2893
9 SASI_Mm01_00166850 predicted 3109
10 SASI_Mm02_00349466 predicted 3175
11 SASI_Mm01_00166844 predicted 2897
12 SASI_Mm01_00166847 predicted 2564
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019973
VALIDATED
SON MISSION shRNA Bacterial Glycerol Stock
SON DNA binding protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019973.2-6726s21c1
Sequence:CCGGGTACCAGCCATTGGCGATAATCTCGAGATTATCGCCAATGGCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019973.2-2104s21c1
Sequence:CCGGACAGCGCTGGAATCCTATAATCTCGAGATTATAGGATTCCAGCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019973.2-6179s21c1
Sequence:CCGGCGGTCAGATTAAGGCGATCAACTCGAGTTGATCGCCTTAATCTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019973.2-4770s21c1
Sequence:CCGGCCTTACTGTAAACAGTCATTTCTCGAGAAATGACTGTTTACAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019973.2-5350s21c1
Sequence:CCGGGCTGACTTAGTGAGACCATTACTCGAGTAATGGTCTCACTAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019973.1-6364s1c1
Sequence:CCGGGCCTACAGTTTCGTTTCCATTCTCGAGAATGGAAACGAAACTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019973.1-4594s1c1
Sequence:CCGGCCTTACTGTAAACAGTCATTTCTCGAGAAATGACTGTTTACAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019973.1-2936s1c1
Sequence:CCGGCGCTCTATGATGTCTTATGAACTCGAGTTCATAAGACATCATAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019973.1-5174s1c1
Sequence:CCGGGCTGACTTAGTGAGACCATTACTCGAGTAATGGTCTCACTAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019973.1-6003s1c1
Sequence:CCGGCGGTCAGATTAAGGCGATCAACTCGAGTTGATCGCCTTAATCTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019973
VALIDATED
SON MISSION shRNA shRNA Plasmid DNA
SON DNA binding protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019973.2-6726s21c1
Sequence:CCGGGTACCAGCCATTGGCGATAATCTCGAGATTATCGCCAATGGCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019973.2-2104s21c1
Sequence:CCGGACAGCGCTGGAATCCTATAATCTCGAGATTATAGGATTCCAGCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019973.2-6179s21c1
Sequence:CCGGCGGTCAGATTAAGGCGATCAACTCGAGTTGATCGCCTTAATCTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019973.2-4770s21c1
Sequence:CCGGCCTTACTGTAAACAGTCATTTCTCGAGAAATGACTGTTTACAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019973.2-5350s21c1
Sequence:CCGGGCTGACTTAGTGAGACCATTACTCGAGTAATGGTCTCACTAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019973.1-6364s1c1
Sequence:CCGGGCCTACAGTTTCGTTTCCATTCTCGAGAATGGAAACGAAACTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019973.1-4594s1c1
Sequence:CCGGCCTTACTGTAAACAGTCATTTCTCGAGAAATGACTGTTTACAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019973.1-2936s1c1
Sequence:CCGGCGCTCTATGATGTCTTATGAACTCGAGTTCATAAGACATCATAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019973.1-5174s1c1
Sequence:CCGGGCTGACTTAGTGAGACCATTACTCGAGTAATGGTCTCACTAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019973.1-6003s1c1
Sequence:CCGGCGGTCAGATTAAGGCGATCAACTCGAGTTGATCGCCTTAATCTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019973
VALIDATED
SON MISSION shRNA Lentiviral Transduction Particles
SON DNA binding protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019973.2-6726s21c1
Sequence:CCGGGTACCAGCCATTGGCGATAATCTCGAGATTATCGCCAATGGCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019973.2-2104s21c1
Sequence:CCGGACAGCGCTGGAATCCTATAATCTCGAGATTATAGGATTCCAGCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019973.2-6179s21c1
Sequence:CCGGCGGTCAGATTAAGGCGATCAACTCGAGTTGATCGCCTTAATCTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019973.2-4770s21c1
Sequence:CCGGCCTTACTGTAAACAGTCATTTCTCGAGAAATGACTGTTTACAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019973.2-5350s21c1
Sequence:CCGGGCTGACTTAGTGAGACCATTACTCGAGTAATGGTCTCACTAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019973.1-6364s1c1
Sequence:CCGGGCCTACAGTTTCGTTTCCATTCTCGAGAATGGAAACGAAACTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019973.1-4594s1c1
Sequence:CCGGCCTTACTGTAAACAGTCATTTCTCGAGAAATGACTGTTTACAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019973.1-2936s1c1
Sequence:CCGGCGCTCTATGATGTCTTATGAACTCGAGTTCATAAGACATCATAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019973.1-5174s1c1
Sequence:CCGGGCTGACTTAGTGAGACCATTACTCGAGTAATGGTCTCACTAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019973.1-6003s1c1
Sequence:CCGGCGGTCAGATTAAGGCGATCAACTCGAGTTGATCGCCTTAATCTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138927
SON MISSION shRNA Bacterial Glycerol Stock
SON DNA binding protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000303921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138927.1-2205s21c1
Sequence:CCGGACACCATGGAGACCCATATATCTCGAGATATATGGGTCTCCATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138927.1-3215s21c1
Sequence:CCGGCGCTCTATGATGTCAGCTTATCTCGAGATAAGCTGACATCATAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138927.1-7462s21c1
Sequence:CCGGAGGAGTGCCTCACGTAGATAGCTCGAGCTATCTACGTGAGGCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138927.1-268s21c1
Sequence:CCGGAGATACAGAACTACGATATAACTCGAGTTATATCGTAGTTCTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138927.1-2084s21c1
Sequence:CCGGACAGCGCTGGAATCCTATAATCTCGAGATTATAGGATTCCAGCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138927
SON MISSION shRNA shRNA Plasmid DNA
SON DNA binding protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000303921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138927.1-2205s21c1
Sequence:CCGGACACCATGGAGACCCATATATCTCGAGATATATGGGTCTCCATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138927.1-3215s21c1
Sequence:CCGGCGCTCTATGATGTCAGCTTATCTCGAGATAAGCTGACATCATAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138927.1-7462s21c1
Sequence:CCGGAGGAGTGCCTCACGTAGATAGCTCGAGCTATCTACGTGAGGCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138927.1-268s21c1
Sequence:CCGGAGATACAGAACTACGATATAACTCGAGTTATATCGTAGTTCTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138927.1-2084s21c1
Sequence:CCGGACAGCGCTGGAATCCTATAATCTCGAGATTATAGGATTCCAGCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138927
SON MISSION shRNA Lentiviral Transduction Particles
SON DNA binding protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000303921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138927.1-2205s21c1
Sequence:CCGGACACCATGGAGACCCATATATCTCGAGATATATGGGTCTCCATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138927.1-3215s21c1
Sequence:CCGGCGCTCTATGATGTCAGCTTATCTCGAGATAAGCTGACATCATAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138927.1-7462s21c1
Sequence:CCGGAGGAGTGCCTCACGTAGATAGCTCGAGCTATCTACGTGAGGCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138927.1-268s21c1
Sequence:CCGGAGATACAGAACTACGATATAACTCGAGTTATATCGTAGTTCTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138927.1-2084s21c1
Sequence:CCGGACAGCGCTGGAATCCTATAATCTCGAGATTATAGGATTCCAGCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003103
VALIDATED
SON MISSION shRNA Bacterial Glycerol Stock
SON DNA binding protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003103.5-5120s1c1
Sequence:CCGGGCAGATTTAGTGAGACCGTTACTCGAGTAACGGTCTCACTAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003103.5-3691s1c1
Sequence:CCGGGCCAGAATCTTCAATTACGTTCTCGAGAACGTAATTGAAGATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003103.5-799s1c1
Sequence:CCGGGCCTACTACAACACTGGTGTTCTCGAGAACACCAGTGTTGTAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003103.5-3095s1c1
Sequence:CCGGCGCTCTATGATGTCAGCTTATCTCGAGATAAGCTGACATCATAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003103.5-7245s1c1
Sequence:CCGGCCCTAATAAGAAGCATGCTAACTCGAGTTAGCATGCTTCTTATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003103
VALIDATED
SON MISSION shRNA shRNA Plasmid DNA
SON DNA binding protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003103.5-5120s1c1
Sequence:CCGGGCAGATTTAGTGAGACCGTTACTCGAGTAACGGTCTCACTAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003103.5-3691s1c1
Sequence:CCGGGCCAGAATCTTCAATTACGTTCTCGAGAACGTAATTGAAGATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003103.5-799s1c1
Sequence:CCGGGCCTACTACAACACTGGTGTTCTCGAGAACACCAGTGTTGTAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003103.5-3095s1c1
Sequence:CCGGCGCTCTATGATGTCAGCTTATCTCGAGATAAGCTGACATCATAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003103.5-7245s1c1
Sequence:CCGGCCCTAATAAGAAGCATGCTAACTCGAGTTAGCATGCTTCTTATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003103
VALIDATED
SON MISSION shRNA Lentiviral Transduction Particles
SON DNA binding protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003103.5-5120s1c1
Sequence:CCGGGCAGATTTAGTGAGACCGTTACTCGAGTAACGGTCTCACTAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003103.5-3691s1c1
Sequence:CCGGGCCAGAATCTTCAATTACGTTCTCGAGAACGTAATTGAAGATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003103.5-799s1c1
Sequence:CCGGGCCTACTACAACACTGGTGTTCTCGAGAACACCAGTGTTGTAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003103.5-3095s1c1
Sequence:CCGGCGCTCTATGATGTCAGCTTATCTCGAGATAAGCTGACATCATAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003103.5-7245s1c1
Sequence:CCGGCCCTAATAAGAAGCATGCTAACTCGAGTTAGCATGCTTCTTATTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks